Incidental Mutation 'R8314:Nectin4'
ID641543
Institutional Source Beutler Lab
Gene Symbol Nectin4
Ensembl Gene ENSMUSG00000006411
Gene Namenectin cell adhesion molecule 4
Synonyms1200017F15Rik, Prr4, Pvrl4, nectin 4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8314 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171370099-171388598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171384727 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 298 (T298A)
Ref Sequence ENSEMBL: ENSMUSP00000006578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006578] [ENSMUST00000056449] [ENSMUST00000094325] [ENSMUST00000111286]
Predicted Effect probably benign
Transcript: ENSMUST00000006578
AA Change: T298A

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000006578
Gene: ENSMUSG00000006411
AA Change: T298A

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 4e-4 PFAM
Pfam:C2-set_2 150 233 9e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056449
SMART Domains Protein: ENSMUSP00000059389
Gene: ENSMUSG00000048865

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
RhoGAP 31 212 1.4e-61 SMART
Blast:RhoGAP 225 285 2e-24 BLAST
low complexity region 348 366 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
low complexity region 498 510 N/A INTRINSIC
low complexity region 514 534 N/A INTRINSIC
low complexity region 667 690 N/A INTRINSIC
low complexity region 736 752 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094325
AA Change: T298A

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091883
Gene: ENSMUSG00000006411
AA Change: T298A

DomainStartEndE-ValueType
IG 36 145 9.26e-8 SMART
Pfam:Ig_2 147 241 2.1e-4 PFAM
Pfam:C2-set_2 150 233 8.7e-17 PFAM
IGc2 259 321 9.78e-7 SMART
transmembrane domain 348 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111286
AA Change: T298A

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106917
Gene: ENSMUSG00000006411
AA Change: T298A

DomainStartEndE-ValueType
IG 100 209 9.26e-8 SMART
Pfam:C2-set_2 214 297 1.2e-16 PFAM
IGc2 323 385 9.78e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family. The encoded protein contains two immunoglobulin-like (Ig-like) C2-type domains and one Ig-like V-type domain. It is involved in cell adhesion through trans-homophilic and -heterophilic interactions. It is a single-pass type I membrane protein. The soluble form is produced by proteolytic cleavage at the cell surface by the metalloproteinase ADAM17/TACE. The secreted form is found in both breast tumor cell lines and breast tumor patients. Mutations in this gene are the cause of ectodermal dysplasia-syndactyly syndrome type 1, an autosomal recessive disorder. Alternatively spliced transcript variants have been found but the full-length nature of the variant has not been determined.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,928 T84S probably benign Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930533K18Rik A G 10: 70,875,276 T76A noncoding transcript Het
Adgrl1 C T 8: 83,938,389 T1235I probably damaging Het
Ak4 C T 4: 101,463,585 T197M possibly damaging Het
Alox12e T C 11: 70,316,172 M603V possibly damaging Het
Ap3d1 A T 10: 80,723,539 I267N possibly damaging Het
Arhgef2 T A 3: 88,621,293 I12N probably benign Het
Asnsd1 A T 1: 53,346,655 M520K probably damaging Het
B3galt5 T C 16: 96,315,449 L94P probably damaging Het
Birc3 T C 9: 7,872,941 probably benign Het
Cd177 T C 7: 24,750,588 S541G probably benign Het
Cdh8 T C 8: 99,171,379 D434G probably damaging Het
Ciita A T 16: 10,510,988 R379W probably damaging Het
Cntrl T A 2: 35,175,143 M2153K probably benign Het
Csmd1 A T 8: 16,158,244 D1232E probably benign Het
Cyp4a30b A C 4: 115,458,338 H252P probably benign Het
Dad1 G A 14: 54,253,812 R11W probably damaging Het
Ddit3 A G 10: 127,295,721 probably null Het
Dzank1 A G 2: 144,502,958 L293P probably damaging Het
Edf1 A G 2: 25,557,965 D5G probably damaging Het
Ep400 T A 5: 110,755,753 M327L unknown Het
Fam135a A T 1: 24,021,921 H1341Q possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam189b T C 3: 89,188,146 probably null Het
Fbxl3 C T 14: 103,089,440 V169I probably benign Het
Gm4787 A G 12: 81,379,135 L83P probably damaging Het
Habp4 A G 13: 64,184,751 E392G probably damaging Het
Hspg2 C A 4: 137,539,675 P1997Q probably benign Het
Ints9 T C 14: 65,029,030 S444P probably damaging Het
Kif18b G A 11: 102,913,074 S420L probably benign Het
Klhl17 T A 4: 156,234,013 M51L probably benign Het
Kmt2b C T 7: 30,578,922 E1555K probably damaging Het
Malrd1 T A 2: 15,752,832 D972E unknown Het
Mapk8ip3 A T 17: 24,901,774 S805R probably benign Het
Mmp13 G A 9: 7,272,931 C97Y probably damaging Het
Moxd1 T A 10: 24,252,540 N163K possibly damaging Het
Nbea T C 3: 56,009,251 I863V probably damaging Het
Ntn1 T C 11: 68,385,624 D166G probably damaging Het
Olfr1137 A G 2: 87,711,202 F235L probably benign Het
Olfr140 T C 2: 90,052,097 T76A probably benign Het
Olfr391-ps T G 11: 73,799,742 N5T noncoding transcript Het
Olfr620 T C 7: 103,612,047 Q102R probably damaging Het
Olfr948 A G 9: 39,319,305 F103S probably damaging Het
Opa3 C A 7: 19,245,015 A135E possibly damaging Het
Osbpl5 T C 7: 143,695,096 I608V probably benign Het
Phc1 A C 6: 122,320,978 S782R unknown Het
Pip5k1b T A 19: 24,355,199 T374S probably benign Het
Prkaa1 A G 15: 5,178,873 S541G probably damaging Het
Ptpn20 A G 14: 33,622,547 N143D possibly damaging Het
Rabep1 A G 11: 70,893,660 D207G possibly damaging Het
Rbbp8 G A 18: 11,720,625 M296I probably benign Het
Recql4 C A 15: 76,710,180 R46L probably damaging Het
Scgb2b18 T C 7: 33,173,157 I74M probably benign Het
Shc4 A G 2: 125,655,616 I391T possibly damaging Het
Slc38a4 A G 15: 97,010,309 F184L probably benign Het
Smim13 G T 13: 41,272,634 G49* probably null Het
Tbc1d19 A G 5: 53,897,047 D459G probably damaging Het
Tnpo1 T C 13: 98,884,625 N82S possibly damaging Het
Tpp2 G A 1: 43,934,227 V47I probably benign Het
Umodl1 G T 17: 30,984,832 A540S probably damaging Het
Vmn2r83 G A 10: 79,481,479 V519I possibly damaging Het
Zfp641 T C 15: 98,290,583 I139V probably damaging Het
Zfyve21 A T 12: 111,823,281 I60F probably benign Het
Other mutations in Nectin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Nectin4 APN 1 171384686 missense probably damaging 1.00
IGL01558:Nectin4 APN 1 171384689 missense probably benign 0.00
IGL02608:Nectin4 APN 1 171384773 missense probably benign 0.05
R2047:Nectin4 UTSW 1 171385152 missense possibly damaging 0.61
R2203:Nectin4 UTSW 1 171386229 missense possibly damaging 0.78
R2518:Nectin4 UTSW 1 171380208 missense probably benign 0.00
R4125:Nectin4 UTSW 1 171385733 missense probably benign 0.02
R4708:Nectin4 UTSW 1 171385146 missense probably benign 0.02
R4856:Nectin4 UTSW 1 171384815 missense possibly damaging 0.46
R4886:Nectin4 UTSW 1 171384815 missense possibly damaging 0.46
R5222:Nectin4 UTSW 1 171385257 splice site probably null
R5264:Nectin4 UTSW 1 171383705 missense probably benign 0.00
R5661:Nectin4 UTSW 1 171385170 missense probably damaging 1.00
R6466:Nectin4 UTSW 1 171386753 missense probably damaging 1.00
R6714:Nectin4 UTSW 1 171370650 start gained probably benign
R7272:Nectin4 UTSW 1 171386644 missense probably damaging 1.00
R7302:Nectin4 UTSW 1 171386635 nonsense probably null
R7318:Nectin4 UTSW 1 171380463 missense probably benign 0.16
R7669:Nectin4 UTSW 1 171380259 missense probably benign 0.00
R7732:Nectin4 UTSW 1 171386678 missense probably benign 0.00
R7751:Nectin4 UTSW 1 171383758 critical splice donor site probably null
R7912:Nectin4 UTSW 1 171380373 missense possibly damaging 0.86
R7993:Nectin4 UTSW 1 171383754 missense probably damaging 1.00
R8029:Nectin4 UTSW 1 171386687 missense probably benign 0.04
R8306:Nectin4 UTSW 1 171383757 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GAATCATGTGGGATGGCATGC -3'
(R):5'- TGGGACAGACACATCCACAG -3'

Sequencing Primer
(F):5'- GGATCTTCCCCCAAGTGTGTG -3'
(R):5'- CAGCTTAATCCTTTCCAAAACATATC -3'
Posted On2020-07-28