Incidental Mutation 'R0104:Mlst8'
ID64155
Institutional Source Beutler Lab
Gene Symbol Mlst8
Ensembl Gene ENSMUSG00000024142
Gene NameMTOR associated protein, LST8 homolog (S. cerevisiae)
SynonymsGbl, mLST8, 0610033N12Rik
MMRRC Submission 038390-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0104 (G1)
Quality Score97
Status Not validated
Chromosome17
Chromosomal Location24473550-24479078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24476117 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 264 (N264S)
Ref Sequence ENSEMBL: ENSMUSP00000136287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053024] [ENSMUST00000054946] [ENSMUST00000070888] [ENSMUST00000164508] [ENSMUST00000179163]
Predicted Effect probably benign
Transcript: ENSMUST00000053024
SMART Domains Protein: ENSMUSP00000052866
Gene: ENSMUSG00000043445

DomainStartEndE-ValueType
Pfam:Hydrolase 28 270 9.3e-14 PFAM
Pfam:Hydrolase_6 31 139 7.2e-30 PFAM
Pfam:Hydrolase_like 232 315 3.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054946
SMART Domains Protein: ENSMUSP00000059792
Gene: ENSMUSG00000045744

DomainStartEndE-ValueType
BRICHOS 44 139 1.15e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000070888
AA Change: N264S

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065004
Gene: ENSMUSG00000024142
AA Change: N264S

DomainStartEndE-ValueType
Blast:WD40 1 28 6e-11 BLAST
WD40 31 69 1.67e-1 SMART
WD40 74 113 1.19e-6 SMART
WD40 118 156 1.63e-4 SMART
WD40 159 198 4.46e-1 SMART
WD40 209 248 2.26e-7 SMART
WD40 259 298 1.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164508
SMART Domains Protein: ENSMUSP00000130417
Gene: ENSMUSG00000045744

DomainStartEndE-ValueType
BRICHOS 44 139 1.15e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179163
AA Change: N264S

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136287
Gene: ENSMUSG00000024142
AA Change: N264S

DomainStartEndE-ValueType
Pfam:WD40 8 28 3.7e-3 PFAM
WD40 31 69 1.67e-1 SMART
WD40 74 113 1.19e-6 SMART
WD40 118 156 1.63e-4 SMART
WD40 159 198 4.46e-1 SMART
WD40 209 248 2.26e-7 SMART
WD40 259 298 1.7e-2 SMART
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation exhibit lethality around E10.5 and abnormal yolk sac vasculature, brain development and heart development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dnah5 A T 15: 28,453,353 E4423D possibly damaging Het
Fsip2 A T 2: 82,978,973 T1879S possibly damaging Het
Gm136 G T 4: 34,746,593 H139Q possibly damaging Het
Ifrd2 T A 9: 107,587,917 L10H probably damaging Het
Itpr3 C A 17: 27,095,992 H704Q probably benign Het
Kcng1 A G 2: 168,269,046 I66T probably damaging Het
Kcnv2 T C 19: 27,323,219 Y157H probably damaging Het
Leng8 A G 7: 4,143,808 D443G probably damaging Het
Pcdhb8 A G 18: 37,355,665 E132G probably benign Het
Pmpcb C G 5: 21,746,038 S266* probably null Het
Prmt7 T C 8: 106,237,350 I292T probably damaging Het
Rif1 T C 2: 52,110,092 L1186S possibly damaging Het
Sox30 A C 11: 45,981,314 E332A possibly damaging Het
Taf2 T C 15: 55,038,338 D820G probably benign Het
Tas2r120 T A 6: 132,657,846 probably null Het
Zfp655 T C 5: 145,244,015 S228P probably damaging Het
Zfyve9 C A 4: 108,718,163 D574Y probably damaging Het
Other mutations in Mlst8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Mlst8 APN 17 24477313 missense probably damaging 1.00
IGL01893:Mlst8 APN 17 24477987 missense probably benign 0.02
IGL02984:Mlst8 UTSW 17 24476153 missense probably damaging 0.98
R0104:Mlst8 UTSW 17 24476117 missense possibly damaging 0.55
R1915:Mlst8 UTSW 17 24477290 nonsense probably null
R1952:Mlst8 UTSW 17 24478013 frame shift probably null
R1953:Mlst8 UTSW 17 24478013 frame shift probably null
R1954:Mlst8 UTSW 17 24477221 missense probably damaging 1.00
R3405:Mlst8 UTSW 17 24478125 missense probably benign 0.03
R3406:Mlst8 UTSW 17 24478125 missense probably benign 0.03
R4517:Mlst8 UTSW 17 24476057 missense probably damaging 0.96
R5021:Mlst8 UTSW 17 24477219 missense possibly damaging 0.93
R6344:Mlst8 UTSW 17 24477326 missense probably damaging 1.00
R6490:Mlst8 UTSW 17 24477961 missense probably benign 0.01
R6668:Mlst8 UTSW 17 24477479 splice site probably null
R6931:Mlst8 UTSW 17 24477275 missense probably damaging 1.00
R7596:Mlst8 UTSW 17 24478110 critical splice donor site probably null
R7685:Mlst8 UTSW 17 24476057 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCATTGAAGGCCAAGCAGACGAC -3'
(R):5'- GGAATCTACAAGCTGTGGGCATGAC -3'

Sequencing Primer
(F):5'- GCAGACGACAGCTTTCTGATG -3'
(R):5'- CATGACCTGGTGTGTGGTAAG -3'
Posted On2013-08-06