Incidental Mutation 'R8314:Tbc1d19'
ID641558
Institutional Source Beutler Lab
Gene Symbol Tbc1d19
Ensembl Gene ENSMUSG00000039178
Gene NameTBC1 domain family, member 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R8314 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location53809606-53903965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53897047 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 459 (D459G)
Ref Sequence ENSEMBL: ENSMUSP00000040585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037337] [ENSMUST00000201958]
Predicted Effect probably damaging
Transcript: ENSMUST00000037337
AA Change: D459G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040585
Gene: ENSMUSG00000039178
AA Change: D459G

DomainStartEndE-ValueType
TBC 248 496 8.07e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202880
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,928 T84S probably benign Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930533K18Rik A G 10: 70,875,276 T76A noncoding transcript Het
Adgrl1 C T 8: 83,938,389 T1235I probably damaging Het
Ak4 C T 4: 101,463,585 T197M possibly damaging Het
Alox12e T C 11: 70,316,172 M603V possibly damaging Het
Ap3d1 A T 10: 80,723,539 I267N possibly damaging Het
Arhgef2 T A 3: 88,621,293 I12N probably benign Het
Asnsd1 A T 1: 53,346,655 M520K probably damaging Het
B3galt5 T C 16: 96,315,449 L94P probably damaging Het
Birc3 T C 9: 7,872,941 probably benign Het
Cd177 T C 7: 24,750,588 S541G probably benign Het
Cdh8 T C 8: 99,171,379 D434G probably damaging Het
Ciita A T 16: 10,510,988 R379W probably damaging Het
Cntrl T A 2: 35,175,143 M2153K probably benign Het
Csmd1 A T 8: 16,158,244 D1232E probably benign Het
Cyp4a30b A C 4: 115,458,338 H252P probably benign Het
Dad1 G A 14: 54,253,812 R11W probably damaging Het
Ddit3 A G 10: 127,295,721 probably null Het
Dzank1 A G 2: 144,502,958 L293P probably damaging Het
Edf1 A G 2: 25,557,965 D5G probably damaging Het
Ep400 T A 5: 110,755,753 M327L unknown Het
Fam135a A T 1: 24,021,921 H1341Q possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam189b T C 3: 89,188,146 probably null Het
Fbxl3 C T 14: 103,089,440 V169I probably benign Het
Gm4787 A G 12: 81,379,135 L83P probably damaging Het
Habp4 A G 13: 64,184,751 E392G probably damaging Het
Hspg2 C A 4: 137,539,675 P1997Q probably benign Het
Ints9 T C 14: 65,029,030 S444P probably damaging Het
Kif18b G A 11: 102,913,074 S420L probably benign Het
Klhl17 T A 4: 156,234,013 M51L probably benign Het
Kmt2b C T 7: 30,578,922 E1555K probably damaging Het
Malrd1 T A 2: 15,752,832 D972E unknown Het
Mapk8ip3 A T 17: 24,901,774 S805R probably benign Het
Mmp13 G A 9: 7,272,931 C97Y probably damaging Het
Moxd1 T A 10: 24,252,540 N163K possibly damaging Het
Nbea T C 3: 56,009,251 I863V probably damaging Het
Nectin4 A G 1: 171,384,727 T298A probably benign Het
Ntn1 T C 11: 68,385,624 D166G probably damaging Het
Olfr1137 A G 2: 87,711,202 F235L probably benign Het
Olfr140 T C 2: 90,052,097 T76A probably benign Het
Olfr391-ps T G 11: 73,799,742 N5T noncoding transcript Het
Olfr620 T C 7: 103,612,047 Q102R probably damaging Het
Olfr948 A G 9: 39,319,305 F103S probably damaging Het
Opa3 C A 7: 19,245,015 A135E possibly damaging Het
Osbpl5 T C 7: 143,695,096 I608V probably benign Het
Phc1 A C 6: 122,320,978 S782R unknown Het
Pip5k1b T A 19: 24,355,199 T374S probably benign Het
Prkaa1 A G 15: 5,178,873 S541G probably damaging Het
Ptpn20 A G 14: 33,622,547 N143D possibly damaging Het
Rabep1 A G 11: 70,893,660 D207G possibly damaging Het
Rbbp8 G A 18: 11,720,625 M296I probably benign Het
Recql4 C A 15: 76,710,180 R46L probably damaging Het
Scgb2b18 T C 7: 33,173,157 I74M probably benign Het
Shc4 A G 2: 125,655,616 I391T possibly damaging Het
Slc38a4 A G 15: 97,010,309 F184L probably benign Het
Smim13 G T 13: 41,272,634 G49* probably null Het
Tnpo1 T C 13: 98,884,625 N82S possibly damaging Het
Tpp2 G A 1: 43,934,227 V47I probably benign Het
Umodl1 G T 17: 30,984,832 A540S probably damaging Het
Vmn2r83 G A 10: 79,481,479 V519I possibly damaging Het
Zfp641 T C 15: 98,290,583 I139V probably damaging Het
Zfyve21 A T 12: 111,823,281 I60F probably benign Het
Other mutations in Tbc1d19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Tbc1d19 APN 5 53897062 nonsense probably null
IGL01684:Tbc1d19 APN 5 53856879 missense probably benign 0.31
IGL02476:Tbc1d19 APN 5 53889413 splice site probably null
IGL02869:Tbc1d19 APN 5 53835217 missense probably benign 0.02
IGL03036:Tbc1d19 APN 5 53897047 missense probably damaging 1.00
IGL03099:Tbc1d19 APN 5 53883655 splice site probably benign
LCD18:Tbc1d19 UTSW 5 53816709 intron probably benign
R0194:Tbc1d19 UTSW 5 53860156 missense probably damaging 1.00
R1729:Tbc1d19 UTSW 5 53829372 missense probably damaging 1.00
R1776:Tbc1d19 UTSW 5 53889311 splice site probably null
R1784:Tbc1d19 UTSW 5 53829372 missense probably damaging 1.00
R1902:Tbc1d19 UTSW 5 53829353 missense probably benign 0.00
R3431:Tbc1d19 UTSW 5 53848206 unclassified probably benign
R3432:Tbc1d19 UTSW 5 53848206 unclassified probably benign
R4333:Tbc1d19 UTSW 5 53872277 missense possibly damaging 0.93
R4335:Tbc1d19 UTSW 5 53872277 missense possibly damaging 0.93
R4681:Tbc1d19 UTSW 5 53872253 missense probably damaging 1.00
R4812:Tbc1d19 UTSW 5 53809806 missense probably damaging 0.99
R5178:Tbc1d19 UTSW 5 53889325 missense possibly damaging 0.84
R5214:Tbc1d19 UTSW 5 53849841 missense probably benign 0.00
R6265:Tbc1d19 UTSW 5 53837924 missense probably benign 0.06
R6372:Tbc1d19 UTSW 5 53856910 missense possibly damaging 0.55
R6494:Tbc1d19 UTSW 5 53829383 missense probably benign 0.13
R6495:Tbc1d19 UTSW 5 53889213 splice site probably null
R6612:Tbc1d19 UTSW 5 53809845 missense possibly damaging 0.88
R6787:Tbc1d19 UTSW 5 53835249 splice site probably null
R6965:Tbc1d19 UTSW 5 53856924 critical splice donor site probably null
R7275:Tbc1d19 UTSW 5 53872276 missense probably damaging 1.00
R7642:Tbc1d19 UTSW 5 53856918 missense probably damaging 0.98
R7655:Tbc1d19 UTSW 5 53897035 missense probably damaging 1.00
R7656:Tbc1d19 UTSW 5 53897035 missense probably damaging 1.00
X0026:Tbc1d19 UTSW 5 53835247 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTCTGACATTCTATAGCTTTTAGG -3'
(R):5'- GGAACGTGTTTTCTAAACCTGC -3'

Sequencing Primer
(F):5'- GCTTTTAGGAAATAAGGAGTCTT -3'
(R):5'- AACGTGTTTTCTAAACCTGCTCAATC -3'
Posted On2020-07-28