Incidental Mutation 'R8314:Phc1'
ID641560
Institutional Source Beutler Lab
Gene Symbol Phc1
Ensembl Gene ENSMUSG00000040669
Gene Namepolyhomeotic 1
Synonymsrae28, Rae-28, Mph1, Edr1
MMRRC Submission
Accession Numbers

Genbank: NM_007905, NM_001042623; MGI: 103248

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8314 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location122317731-122340561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 122320978 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 782 (S782R)
Ref Sequence ENSEMBL: ENSMUSP00000078514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007602] [ENSMUST00000079560] [ENSMUST00000081849] [ENSMUST00000112600] [ENSMUST00000112610] [ENSMUST00000159252] [ENSMUST00000160163] [ENSMUST00000160696] [ENSMUST00000160843] [ENSMUST00000161054] [ENSMUST00000161739]
Predicted Effect probably benign
Transcript: ENSMUST00000007602
SMART Domains Protein: ENSMUSP00000007602
Gene: ENSMUSG00000007458

DomainStartEndE-ValueType
Pfam:Man-6-P_recep 1 278 4.5e-184 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000079560
AA Change: S782R
SMART Domains Protein: ENSMUSP00000078514
Gene: ENSMUSG00000040669
AA Change: S782R

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000081849
AA Change: S730R
SMART Domains Protein: ENSMUSP00000080532
Gene: ENSMUSG00000040669
AA Change: S730R

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000112600
AA Change: S730R
SMART Domains Protein: ENSMUSP00000108219
Gene: ENSMUSG00000040669
AA Change: S730R

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112610
SMART Domains Protein: ENSMUSP00000108229
Gene: ENSMUSG00000007458

DomainStartEndE-ValueType
Pfam:Man-6-P_recep 1 278 3.9e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159252
AA Change: S737R

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124678
Gene: ENSMUSG00000040669
AA Change: S737R

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 46 65 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 195 258 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 328 371 N/A INTRINSIC
coiled coil region 375 401 N/A INTRINSIC
low complexity region 403 435 N/A INTRINSIC
low complexity region 440 461 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 530 542 N/A INTRINSIC
low complexity region 572 583 N/A INTRINSIC
low complexity region 659 677 N/A INTRINSIC
Pfam:zf-FCS 753 788 2.2e-8 PFAM
low complexity region 810 824 N/A INTRINSIC
SAM 898 965 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160163
SMART Domains Protein: ENSMUSP00000125545
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160696
AA Change: S782R
SMART Domains Protein: ENSMUSP00000125580
Gene: ENSMUSG00000040669
AA Change: S782R

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:PHC2_SAM_assoc 834 941 3.4e-31 PFAM
SAM 943 1010 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160843
SMART Domains Protein: ENSMUSP00000125030
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161054
AA Change: S730R
SMART Domains Protein: ENSMUSP00000123911
Gene: ENSMUSG00000040669
AA Change: S730R

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 188 251 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
low complexity region 321 364 N/A INTRINSIC
coiled coil region 368 394 N/A INTRINSIC
low complexity region 396 428 N/A INTRINSIC
low complexity region 433 454 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
low complexity region 652 670 N/A INTRINSIC
Pfam:zf-FCS 746 781 4.6e-8 PFAM
low complexity region 803 817 N/A INTRINSIC
SAM 891 958 9.57e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161290
SMART Domains Protein: ENSMUSP00000125110
Gene: ENSMUSG00000040669

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161739
AA Change: S782R
SMART Domains Protein: ENSMUSP00000125568
Gene: ENSMUSG00000040669
AA Change: S782R

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 240 303 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 373 416 N/A INTRINSIC
coiled coil region 420 446 N/A INTRINSIC
low complexity region 448 480 N/A INTRINSIC
low complexity region 485 506 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 575 587 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
low complexity region 704 722 N/A INTRINSIC
Pfam:zf-FCS 798 833 4.9e-8 PFAM
low complexity region 855 869 N/A INTRINSIC
SAM 943 1010 9.57e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila polyhomeotic gene, which is a member of the Polycomb group of genes. The gene product is a component of a multimeric protein complex that contains EDR2 and the vertebrate Polycomb protein BMH1. The gene product, the EDR2 protein, and the Drosophila polyhomeotic protein share 2 highly conserved domains, named homology domains I and II. These domains are involved in protein-protein interactions and may mediate heterodimerization of the protein encoded by this gene and the EDR2 protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit perinatal lethality, posterior skeletal transformations and defects in neural crest derived tissues, including ocular abnormalities, cleft palate, parathyroid and thymic hypoplasia and cardiac anomalies. Hematopoiesis is impaired in fetal livers. [provided by MGI curators]
Allele List at MGI

All alleles(147) : Targeted, knock-out(1) Gene trapped(146)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,928 T84S probably benign Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930533K18Rik A G 10: 70,875,276 T76A noncoding transcript Het
Adgrl1 C T 8: 83,938,389 T1235I probably damaging Het
Ak4 C T 4: 101,463,585 T197M possibly damaging Het
Alox12e T C 11: 70,316,172 M603V possibly damaging Het
Ap3d1 A T 10: 80,723,539 I267N possibly damaging Het
Arhgef2 T A 3: 88,621,293 I12N probably benign Het
Asnsd1 A T 1: 53,346,655 M520K probably damaging Het
B3galt5 T C 16: 96,315,449 L94P probably damaging Het
Birc3 T C 9: 7,872,941 probably benign Het
Cd177 T C 7: 24,750,588 S541G probably benign Het
Cdh8 T C 8: 99,171,379 D434G probably damaging Het
Ciita A T 16: 10,510,988 R379W probably damaging Het
Cntrl T A 2: 35,175,143 M2153K probably benign Het
Csmd1 A T 8: 16,158,244 D1232E probably benign Het
Cyp4a30b A C 4: 115,458,338 H252P probably benign Het
Dad1 G A 14: 54,253,812 R11W probably damaging Het
Ddit3 A G 10: 127,295,721 probably null Het
Dzank1 A G 2: 144,502,958 L293P probably damaging Het
Edf1 A G 2: 25,557,965 D5G probably damaging Het
Ep400 T A 5: 110,755,753 M327L unknown Het
Fam135a A T 1: 24,021,921 H1341Q possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam189b T C 3: 89,188,146 probably null Het
Fbxl3 C T 14: 103,089,440 V169I probably benign Het
Gm4787 A G 12: 81,379,135 L83P probably damaging Het
Habp4 A G 13: 64,184,751 E392G probably damaging Het
Hspg2 C A 4: 137,539,675 P1997Q probably benign Het
Ints9 T C 14: 65,029,030 S444P probably damaging Het
Kif18b G A 11: 102,913,074 S420L probably benign Het
Klhl17 T A 4: 156,234,013 M51L probably benign Het
Kmt2b C T 7: 30,578,922 E1555K probably damaging Het
Malrd1 T A 2: 15,752,832 D972E unknown Het
Mapk8ip3 A T 17: 24,901,774 S805R probably benign Het
Mmp13 G A 9: 7,272,931 C97Y probably damaging Het
Moxd1 T A 10: 24,252,540 N163K possibly damaging Het
Nbea T C 3: 56,009,251 I863V probably damaging Het
Nectin4 A G 1: 171,384,727 T298A probably benign Het
Ntn1 T C 11: 68,385,624 D166G probably damaging Het
Olfr1137 A G 2: 87,711,202 F235L probably benign Het
Olfr140 T C 2: 90,052,097 T76A probably benign Het
Olfr391-ps T G 11: 73,799,742 N5T noncoding transcript Het
Olfr620 T C 7: 103,612,047 Q102R probably damaging Het
Olfr948 A G 9: 39,319,305 F103S probably damaging Het
Opa3 C A 7: 19,245,015 A135E possibly damaging Het
Osbpl5 T C 7: 143,695,096 I608V probably benign Het
Pip5k1b T A 19: 24,355,199 T374S probably benign Het
Prkaa1 A G 15: 5,178,873 S541G probably damaging Het
Ptpn20 A G 14: 33,622,547 N143D possibly damaging Het
Rabep1 A G 11: 70,893,660 D207G possibly damaging Het
Rbbp8 G A 18: 11,720,625 M296I probably benign Het
Recql4 C A 15: 76,710,180 R46L probably damaging Het
Scgb2b18 T C 7: 33,173,157 I74M probably benign Het
Shc4 A G 2: 125,655,616 I391T possibly damaging Het
Slc38a4 A G 15: 97,010,309 F184L probably benign Het
Smim13 G T 13: 41,272,634 G49* probably null Het
Tbc1d19 A G 5: 53,897,047 D459G probably damaging Het
Tnpo1 T C 13: 98,884,625 N82S possibly damaging Het
Tpp2 G A 1: 43,934,227 V47I probably benign Het
Umodl1 G T 17: 30,984,832 A540S probably damaging Het
Vmn2r83 G A 10: 79,481,479 V519I possibly damaging Het
Zfp641 T C 15: 98,290,583 I139V probably damaging Het
Zfyve21 A T 12: 111,823,281 I60F probably benign Het
Other mutations in Phc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Phc1 APN 6 122322999 splice site probably benign
IGL01354:Phc1 APN 6 122334083 missense probably damaging 1.00
IGL01786:Phc1 APN 6 122319520 missense possibly damaging 0.82
IGL02110:Phc1 APN 6 122322035 missense possibly damaging 0.91
IGL02479:Phc1 APN 6 122323717 unclassified probably benign
IGL02861:Phc1 APN 6 122323789 unclassified probably benign
IGL03106:Phc1 APN 6 122323469 unclassified probably benign
3-1:Phc1 UTSW 6 122338464 intron probably benign
FR4737:Phc1 UTSW 6 122323598 small insertion probably benign
FR4976:Phc1 UTSW 6 122323600 small insertion probably benign
R0452:Phc1 UTSW 6 122323036 missense probably damaging 1.00
R1146:Phc1 UTSW 6 122323457 unclassified probably benign
R1146:Phc1 UTSW 6 122323457 unclassified probably benign
R1301:Phc1 UTSW 6 122325874 missense probably benign 0.03
R1738:Phc1 UTSW 6 122318566 missense probably damaging 1.00
R2056:Phc1 UTSW 6 122333340 missense probably damaging 0.99
R2164:Phc1 UTSW 6 122322337 missense possibly damaging 0.82
R2183:Phc1 UTSW 6 122323325 missense probably damaging 1.00
R2424:Phc1 UTSW 6 122320043 missense probably damaging 0.98
R4378:Phc1 UTSW 6 122335007 missense possibly damaging 0.66
R4648:Phc1 UTSW 6 122321913 missense possibly damaging 0.95
R4831:Phc1 UTSW 6 122337005 start gained probably benign
R5244:Phc1 UTSW 6 122321979 missense probably damaging 1.00
R5475:Phc1 UTSW 6 122334092 missense possibly damaging 0.95
R6491:Phc1 UTSW 6 122334964
R6701:Phc1 UTSW 6 122325774 missense probably damaging 0.96
R6733:Phc1 UTSW 6 122336886 missense possibly damaging 0.77
R7022:Phc1 UTSW 6 122335031 missense probably damaging 0.98
R7383:Phc1 UTSW 6 122323358 missense unknown
R7707:Phc1 UTSW 6 122323780 missense unknown
R7825:Phc1 UTSW 6 122322381 missense probably benign 0.26
R7846:Phc1 UTSW 6 122333370 missense probably damaging 1.00
R8346:Phc1 UTSW 6 122325815 missense probably damaging 0.98
RF036:Phc1 UTSW 6 122323580 small insertion probably benign
RF041:Phc1 UTSW 6 122323600 small insertion probably benign
RF044:Phc1 UTSW 6 122323600 small insertion probably benign
RF064:Phc1 UTSW 6 122323580 small insertion probably benign
X0024:Phc1 UTSW 6 122323629 small deletion probably benign
X0026:Phc1 UTSW 6 122319538 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CACCTGTGCATAGACAGACC -3'
(R):5'- CAGAGCTCATCCAAGCAGAG -3'

Sequencing Primer
(F):5'- TAAAGCTCAGTCAGGTCTACGTG -3'
(R):5'- CTCATCCAAGCAGAGACAAGGG -3'
Posted On2020-07-28