Incidental Mutation 'R8314:Olfr620'
ID641565
Institutional Source Beutler Lab
Gene Symbol Olfr620
Ensembl Gene ENSMUSG00000045132
Gene Nameolfactory receptor 620
SynonymsMOR4-1, GA_x6K02T2PBJ9-6335095-6334154
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R8314 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103604895-103612534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103612047 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 102 (Q102R)
Ref Sequence ENSEMBL: ENSMUSP00000061764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052152]
Predicted Effect probably damaging
Transcript: ENSMUST00000052152
AA Change: Q102R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061764
Gene: ENSMUSG00000045132
AA Change: Q102R

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.6e-137 PFAM
Pfam:7tm_1 43 294 4.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,928 T84S probably benign Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930533K18Rik A G 10: 70,875,276 T76A noncoding transcript Het
Adgrl1 C T 8: 83,938,389 T1235I probably damaging Het
Ak4 C T 4: 101,463,585 T197M possibly damaging Het
Alox12e T C 11: 70,316,172 M603V possibly damaging Het
Ap3d1 A T 10: 80,723,539 I267N possibly damaging Het
Arhgef2 T A 3: 88,621,293 I12N probably benign Het
Asnsd1 A T 1: 53,346,655 M520K probably damaging Het
B3galt5 T C 16: 96,315,449 L94P probably damaging Het
Birc3 T C 9: 7,872,941 probably benign Het
Cd177 T C 7: 24,750,588 S541G probably benign Het
Cdh8 T C 8: 99,171,379 D434G probably damaging Het
Ciita A T 16: 10,510,988 R379W probably damaging Het
Cntrl T A 2: 35,175,143 M2153K probably benign Het
Csmd1 A T 8: 16,158,244 D1232E probably benign Het
Cyp4a30b A C 4: 115,458,338 H252P probably benign Het
Dad1 G A 14: 54,253,812 R11W probably damaging Het
Ddit3 A G 10: 127,295,721 probably null Het
Dzank1 A G 2: 144,502,958 L293P probably damaging Het
Edf1 A G 2: 25,557,965 D5G probably damaging Het
Ep400 T A 5: 110,755,753 M327L unknown Het
Fam135a A T 1: 24,021,921 H1341Q possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam189b T C 3: 89,188,146 probably null Het
Fbxl3 C T 14: 103,089,440 V169I probably benign Het
Gm4787 A G 12: 81,379,135 L83P probably damaging Het
Habp4 A G 13: 64,184,751 E392G probably damaging Het
Hspg2 C A 4: 137,539,675 P1997Q probably benign Het
Ints9 T C 14: 65,029,030 S444P probably damaging Het
Kif18b G A 11: 102,913,074 S420L probably benign Het
Klhl17 T A 4: 156,234,013 M51L probably benign Het
Kmt2b C T 7: 30,578,922 E1555K probably damaging Het
Malrd1 T A 2: 15,752,832 D972E unknown Het
Mapk8ip3 A T 17: 24,901,774 S805R probably benign Het
Mmp13 G A 9: 7,272,931 C97Y probably damaging Het
Moxd1 T A 10: 24,252,540 N163K possibly damaging Het
Nbea T C 3: 56,009,251 I863V probably damaging Het
Nectin4 A G 1: 171,384,727 T298A probably benign Het
Ntn1 T C 11: 68,385,624 D166G probably damaging Het
Olfr1137 A G 2: 87,711,202 F235L probably benign Het
Olfr140 T C 2: 90,052,097 T76A probably benign Het
Olfr391-ps T G 11: 73,799,742 N5T noncoding transcript Het
Olfr948 A G 9: 39,319,305 F103S probably damaging Het
Opa3 C A 7: 19,245,015 A135E possibly damaging Het
Osbpl5 T C 7: 143,695,096 I608V probably benign Het
Phc1 A C 6: 122,320,978 S782R unknown Het
Pip5k1b T A 19: 24,355,199 T374S probably benign Het
Prkaa1 A G 15: 5,178,873 S541G probably damaging Het
Ptpn20 A G 14: 33,622,547 N143D possibly damaging Het
Rabep1 A G 11: 70,893,660 D207G possibly damaging Het
Rbbp8 G A 18: 11,720,625 M296I probably benign Het
Recql4 C A 15: 76,710,180 R46L probably damaging Het
Scgb2b18 T C 7: 33,173,157 I74M probably benign Het
Shc4 A G 2: 125,655,616 I391T possibly damaging Het
Slc38a4 A G 15: 97,010,309 F184L probably benign Het
Smim13 G T 13: 41,272,634 G49* probably null Het
Tbc1d19 A G 5: 53,897,047 D459G probably damaging Het
Tnpo1 T C 13: 98,884,625 N82S possibly damaging Het
Tpp2 G A 1: 43,934,227 V47I probably benign Het
Umodl1 G T 17: 30,984,832 A540S probably damaging Het
Vmn2r83 G A 10: 79,481,479 V519I possibly damaging Het
Zfp641 T C 15: 98,290,583 I139V probably damaging Het
Zfyve21 A T 12: 111,823,281 I60F probably benign Het
Other mutations in Olfr620
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02807:Olfr620 APN 7 103611991 missense probably benign 0.34
R0496:Olfr620 UTSW 7 103611997 missense probably benign 0.09
R0834:Olfr620 UTSW 7 103612237 missense probably benign 0.00
R1957:Olfr620 UTSW 7 103611411 makesense probably null
R1958:Olfr620 UTSW 7 103611411 makesense probably null
R2158:Olfr620 UTSW 7 103612236 missense possibly damaging 0.66
R3797:Olfr620 UTSW 7 103611447 missense probably benign 0.37
R5389:Olfr620 UTSW 7 103611590 nonsense probably null
R6292:Olfr620 UTSW 7 103612179 missense probably damaging 0.99
R6374:Olfr620 UTSW 7 103611921 missense probably benign 0.23
R6422:Olfr620 UTSW 7 103612014 missense probably damaging 1.00
R6586:Olfr620 UTSW 7 103611976 missense possibly damaging 0.81
R7234:Olfr620 UTSW 7 103611882 missense probably damaging 0.97
R7393:Olfr620 UTSW 7 103611991 missense possibly damaging 0.90
R7855:Olfr620 UTSW 7 103611772 missense possibly damaging 0.88
R7900:Olfr620 UTSW 7 103611693 missense possibly damaging 0.82
R8159:Olfr620 UTSW 7 103612140 missense possibly damaging 0.63
R8265:Olfr620 UTSW 7 103611841 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGGCCTGCAGTAATTTAAGAAC -3'
(R):5'- ACGGTGTTCCTGGGAAATTG -3'

Sequencing Primer
(F):5'- CCTGCAGTAATTTAAGAACTTCAGGC -3'
(R):5'- CCTGGGAAATTGTATGGTACTTCATG -3'
Posted On2020-07-28