Incidental Mutation 'R8314:Adgrl1'
ID641568
Institutional Source Beutler Lab
Gene Symbol Adgrl1
Ensembl Gene ENSMUSG00000013033
Gene Nameadhesion G protein-coupled receptor L1
Synonymslectomedin-2, Lec2, Lphn1, 2900070I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8314 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location83900105-83941954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83938389 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1235 (T1235I)
Ref Sequence ENSEMBL: ENSMUSP00000118452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045393] [ENSMUST00000098595] [ENSMUST00000124355] [ENSMUST00000131717] [ENSMUST00000132500] [ENSMUST00000141158] [ENSMUST00000152978]
Predicted Effect probably damaging
Transcript: ENSMUST00000045393
AA Change: T1240I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048422
Gene: ENSMUSG00000013033
AA Change: T1240I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 6.6e-23 PFAM
OLF 142 398 8.5e-138 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 1.4e-23 SMART
low complexity region 579 591 N/A INTRINSIC
low complexity region 747 758 N/A INTRINSIC
GPS 797 849 3.5e-27 SMART
Pfam:7tm_2 856 1092 5.3e-66 PFAM
Pfam:Latrophilin 1112 1470 1.7e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098595
SMART Domains Protein: ENSMUSP00000096195
Gene: ENSMUSG00000074219

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124355
SMART Domains Protein: ENSMUSP00000116064
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.1e-24 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117720
Gene: ENSMUSG00000013033
AA Change: T54I

DomainStartEndE-ValueType
Pfam:Latrophilin 1 213 9.2e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131717
AA Change: T1064I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118579
Gene: ENSMUSG00000013033
AA Change: T1064I

DomainStartEndE-ValueType
OLF 1 222 4.51e-103 SMART
low complexity region 229 265 N/A INTRINSIC
low complexity region 279 294 N/A INTRINSIC
HormR 300 365 2.26e-21 SMART
low complexity region 403 415 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
GPS 621 673 5.64e-25 SMART
Pfam:7tm_2 680 916 7.9e-68 PFAM
Pfam:Latrophilin 936 1295 2.7e-181 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132500
AA Change: T1280I

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119100
Gene: ENSMUSG00000013033
AA Change: T1280I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.6e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 3.4e-68 PFAM
Pfam:Latrophilin 1146 1511 6.4e-193 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141158
AA Change: T1235I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118452
Gene: ENSMUSG00000013033
AA Change: T1235I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 3.4e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 4.5e-68 PFAM
Pfam:Latrophilin 1107 1466 1.1e-180 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152978
AA Change: T1285I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115295
Gene: ENSMUSG00000013033
AA Change: T1285I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 2.1e-25 PFAM
OLF 142 398 1.39e-135 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 2.26e-21 SMART
Pfam:GAIN 544 773 4.1e-59 PFAM
GPS 797 849 5.64e-25 SMART
Pfam:7tm_2 856 1092 2.3e-69 PFAM
Pfam:Latrophilin 1112 1516 7.3e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. Latrophilin-1 has been shown to recruit the neurotoxin from black widow spider venom, alpha-latrotoxin, to the synapse plasma membrane. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a targeted null allele at this locus are viable and fertile. Female homozygotes fail adequately to care for their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,928 T84S probably benign Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930533K18Rik A G 10: 70,875,276 T76A noncoding transcript Het
Ak4 C T 4: 101,463,585 T197M possibly damaging Het
Alox12e T C 11: 70,316,172 M603V possibly damaging Het
Ap3d1 A T 10: 80,723,539 I267N possibly damaging Het
Arhgef2 T A 3: 88,621,293 I12N probably benign Het
Asnsd1 A T 1: 53,346,655 M520K probably damaging Het
B3galt5 T C 16: 96,315,449 L94P probably damaging Het
Birc3 T C 9: 7,872,941 probably benign Het
Cd177 T C 7: 24,750,588 S541G probably benign Het
Cdh8 T C 8: 99,171,379 D434G probably damaging Het
Cdkn3 A T 14: 46,769,873 silent Het
Ciita A T 16: 10,510,988 R379W probably damaging Het
Cntrl T A 2: 35,175,143 M2153K probably benign Het
Csmd1 A T 8: 16,158,244 D1232E probably benign Het
Cyp4a30b A C 4: 115,458,338 H252P probably benign Het
Dad1 G A 14: 54,253,812 R11W probably damaging Het
Ddit3 A G 10: 127,295,721 probably null Het
Dusp22 G A 13: 30,708,931 probably benign Het
Dzank1 A G 2: 144,502,958 L293P probably damaging Het
Edf1 A G 2: 25,557,965 D5G probably damaging Het
Ep400 T A 5: 110,755,753 M327L unknown Het
Fam135a A T 1: 24,021,921 H1341Q possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam189b T C 3: 89,188,146 probably null Het
Fbxl3 C T 14: 103,089,440 V169I probably benign Het
Gm4787 A G 12: 81,379,135 L83P probably damaging Het
Habp4 A G 13: 64,184,751 E392G probably damaging Het
Hspg2 C A 4: 137,539,675 P1997Q probably benign Het
Ints9 T C 14: 65,029,030 S444P probably damaging Het
Kif18b G A 11: 102,913,074 S420L probably benign Het
Klhl17 T A 4: 156,234,013 M51L probably benign Het
Kmt2b C T 7: 30,578,922 E1555K probably damaging Het
Malrd1 T A 2: 15,752,832 D972E unknown Het
Mapk8ip3 A T 17: 24,901,774 S805R probably benign Het
Mmp13 G A 9: 7,272,931 C97Y probably damaging Het
Moxd1 T A 10: 24,252,540 N163K possibly damaging Het
Nbea T C 3: 56,009,251 I863V probably damaging Het
Nectin4 A G 1: 171,384,727 T298A probably benign Het
Net1 T C 13: 3,912,672 probably benign Het
Ntn1 T C 11: 68,385,624 D166G probably damaging Het
Olfr1137 A G 2: 87,711,202 F235L probably benign Het
Olfr140 T C 2: 90,052,097 T76A probably benign Het
Olfr391-ps T G 11: 73,799,742 N5T noncoding transcript Het
Olfr620 T C 7: 103,612,047 Q102R probably damaging Het
Olfr948 A G 9: 39,319,305 F103S probably damaging Het
Opa3 C A 7: 19,245,015 A135E possibly damaging Het
Osbpl5 T C 7: 143,695,096 I608V probably benign Het
Phc1 A C 6: 122,320,978 S782R unknown Het
Pip5k1b T A 19: 24,355,199 T374S probably benign Het
Prkaa1 A G 15: 5,178,873 S541G probably damaging Het
Ptpn20 A G 14: 33,622,547 N143D possibly damaging Het
Rabep1 A G 11: 70,893,660 D207G possibly damaging Het
Rbbp8 G A 18: 11,720,625 M296I probably benign Het
Recql4 C A 15: 76,710,180 R46L probably damaging Het
Scgb2b18 T C 7: 33,173,157 I74M probably benign Het
Shc4 A G 2: 125,655,616 I391T possibly damaging Het
Slc38a4 A G 15: 97,010,309 F184L probably benign Het
Slc7a6 A G 8: 106,168,958 probably benign Het
Smim13 G T 13: 41,272,634 G49* probably null Het
Tbc1d19 A G 5: 53,897,047 D459G probably damaging Het
Tnpo1 T C 13: 98,884,625 N82S possibly damaging Het
Tpp2 G A 1: 43,934,227 V47I probably benign Het
Umodl1 G T 17: 30,984,832 A540S probably damaging Het
Vmn2r83 G A 10: 79,481,479 V519I possibly damaging Het
Zfp641 T C 15: 98,290,583 I139V probably damaging Het
Zfyve21 A T 12: 111,823,281 I60F probably benign Het
Other mutations in Adgrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Adgrl1 APN 8 83937703 missense probably damaging 0.98
IGL01413:Adgrl1 APN 8 83929857 missense probably damaging 1.00
IGL02020:Adgrl1 APN 8 83932948 missense probably benign 0.09
IGL02422:Adgrl1 APN 8 83937486 missense probably damaging 1.00
IGL03065:Adgrl1 APN 8 83938514 missense possibly damaging 0.95
IGL03169:Adgrl1 APN 8 83931995 missense probably damaging 0.97
IGL03237:Adgrl1 APN 8 83929683 splice site probably null
Swiss_rolls UTSW 8 83918922 missense probably damaging 0.99
R0375:Adgrl1 UTSW 8 83934901 missense probably damaging 0.99
R0505:Adgrl1 UTSW 8 83934650 splice site probably benign
R0681:Adgrl1 UTSW 8 83934650 splice site probably benign
R0964:Adgrl1 UTSW 8 83934412 splice site probably benign
R1182:Adgrl1 UTSW 8 83929822 missense probably damaging 1.00
R1373:Adgrl1 UTSW 8 83937763 missense probably benign 0.23
R1475:Adgrl1 UTSW 8 83938350 missense possibly damaging 0.60
R1610:Adgrl1 UTSW 8 83932373 missense probably benign 0.16
R1778:Adgrl1 UTSW 8 83930037 missense probably damaging 1.00
R2089:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2091:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2091:Adgrl1 UTSW 8 83934464 missense probably damaging 1.00
R2300:Adgrl1 UTSW 8 83930117 nonsense probably null
R2403:Adgrl1 UTSW 8 83931241 missense probably benign 0.01
R2935:Adgrl1 UTSW 8 83934560 missense probably damaging 1.00
R3772:Adgrl1 UTSW 8 83923004 missense possibly damaging 0.59
R4191:Adgrl1 UTSW 8 83938940 missense probably benign 0.29
R4393:Adgrl1 UTSW 8 83938593 missense probably benign 0.01
R4406:Adgrl1 UTSW 8 83930042 missense probably damaging 1.00
R4445:Adgrl1 UTSW 8 83934860 missense probably damaging 1.00
R4782:Adgrl1 UTSW 8 83935573 missense probably benign 0.08
R4799:Adgrl1 UTSW 8 83935573 missense probably benign 0.08
R5214:Adgrl1 UTSW 8 83915573 splice site probably null
R5242:Adgrl1 UTSW 8 83931082 missense possibly damaging 0.47
R5409:Adgrl1 UTSW 8 83929742 missense probably damaging 1.00
R5522:Adgrl1 UTSW 8 83923075 missense possibly damaging 0.93
R5607:Adgrl1 UTSW 8 83937257 missense probably damaging 1.00
R5608:Adgrl1 UTSW 8 83937257 missense probably damaging 1.00
R5652:Adgrl1 UTSW 8 83929815 missense probably damaging 1.00
R5655:Adgrl1 UTSW 8 83938601 missense possibly damaging 0.89
R5919:Adgrl1 UTSW 8 83932610 missense probably damaging 1.00
R6033:Adgrl1 UTSW 8 83918922 missense probably damaging 0.99
R6033:Adgrl1 UTSW 8 83918922 missense probably damaging 0.99
R6129:Adgrl1 UTSW 8 83918987 missense probably damaging 1.00
R6221:Adgrl1 UTSW 8 83937687 nonsense probably null
R7142:Adgrl1 UTSW 8 83937200 missense probably benign 0.38
R7181:Adgrl1 UTSW 8 83926249 splice site probably null
R7238:Adgrl1 UTSW 8 83939064 missense probably damaging 0.99
R7547:Adgrl1 UTSW 8 83938884 missense probably benign 0.00
R7709:Adgrl1 UTSW 8 83938988 missense probably benign 0.03
R7741:Adgrl1 UTSW 8 83929714 missense probably damaging 1.00
R7852:Adgrl1 UTSW 8 83935558 missense probably damaging 1.00
R7866:Adgrl1 UTSW 8 83937935 critical splice donor site probably null
R8146:Adgrl1 UTSW 8 83930989 missense possibly damaging 0.64
RF007:Adgrl1 UTSW 8 83934772 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACACCCCTGTCAGCCTATTG -3'
(R):5'- GGGCCTTGTAGAGAAGTTCAATC -3'

Sequencing Primer
(F):5'- TTGCCTACCTATCCAACCA -3'
(R):5'- AGAAGTTCAATCTCTGCCCGG -3'
Posted On2020-07-28