Incidental Mutation 'R0104:Pcdhb8'
ID64157
Institutional Source Beutler Lab
Gene Symbol Pcdhb8
Ensembl Gene ENSMUSG00000045876
Gene Nameprotocadherin beta 8
SynonymsPcdhb5C, PcdhbH
MMRRC Submission 038390-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0104 (G1)
Quality Score100
Status Not validated
Chromosome18
Chromosomal Location37355121-37358604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37355665 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 132 (E132G)
Ref Sequence ENSEMBL: ENSMUSP00000054371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051163] [ENSMUST00000115661] [ENSMUST00000192867] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051163
AA Change: E132G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000054371
Gene: ENSMUSG00000045876
AA Change: E132G

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 6.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 9.51e-26 SMART
CA 588 669 5.65e-10 SMART
Pfam:Cadherin_C_2 685 768 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192867
SMART Domains Protein: ENSMUSP00000141814
Gene: ENSMUSG00000045876

DomainStartEndE-ValueType
CA 26 104 7e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dnah5 A T 15: 28,453,353 E4423D possibly damaging Het
Fsip2 A T 2: 82,978,973 T1879S possibly damaging Het
Gm136 G T 4: 34,746,593 H139Q possibly damaging Het
Ifrd2 T A 9: 107,587,917 L10H probably damaging Het
Itpr3 C A 17: 27,095,992 H704Q probably benign Het
Kcng1 A G 2: 168,269,046 I66T probably damaging Het
Kcnv2 T C 19: 27,323,219 Y157H probably damaging Het
Leng8 A G 7: 4,143,808 D443G probably damaging Het
Mlst8 T C 17: 24,476,117 N264S possibly damaging Het
Pmpcb C G 5: 21,746,038 S266* probably null Het
Prmt7 T C 8: 106,237,350 I292T probably damaging Het
Rif1 T C 2: 52,110,092 L1186S possibly damaging Het
Sox30 A C 11: 45,981,314 E332A possibly damaging Het
Taf2 T C 15: 55,038,338 D820G probably benign Het
Tas2r120 T A 6: 132,657,846 probably null Het
Zfp655 T C 5: 145,244,015 S228P probably damaging Het
Zfyve9 C A 4: 108,718,163 D574Y probably damaging Het
Other mutations in Pcdhb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Pcdhb8 APN 18 37355473 missense probably benign 0.00
IGL00574:Pcdhb8 APN 18 37356370 missense probably damaging 1.00
IGL00960:Pcdhb8 APN 18 37355973 missense probably benign 0.28
IGL01103:Pcdhb8 APN 18 37357200 missense probably damaging 1.00
IGL01330:Pcdhb8 APN 18 37357578 missense probably benign 0.12
IGL01413:Pcdhb8 APN 18 37355976 missense probably damaging 1.00
IGL01418:Pcdhb8 APN 18 37355976 missense probably damaging 1.00
IGL01608:Pcdhb8 APN 18 37356925 missense probably damaging 1.00
IGL02212:Pcdhb8 APN 18 37356412 missense possibly damaging 0.95
IGL02582:Pcdhb8 APN 18 37355374 missense possibly damaging 0.79
IGL02607:Pcdhb8 APN 18 37357581 missense probably benign 0.00
IGL02882:Pcdhb8 APN 18 37356223 missense possibly damaging 0.95
IGL03005:Pcdhb8 APN 18 37357534 missense probably damaging 1.00
IGL03108:Pcdhb8 APN 18 37357246 missense probably damaging 1.00
PIT4468001:Pcdhb8 UTSW 18 37356633 missense probably damaging 1.00
R0490:Pcdhb8 UTSW 18 37356780 missense probably damaging 1.00
R0617:Pcdhb8 UTSW 18 37357047 missense probably benign 0.02
R1168:Pcdhb8 UTSW 18 37356727 missense probably benign
R1189:Pcdhb8 UTSW 18 37356567 nonsense probably null
R1232:Pcdhb8 UTSW 18 37355775 missense probably benign 0.28
R1503:Pcdhb8 UTSW 18 37356519 missense probably damaging 1.00
R1576:Pcdhb8 UTSW 18 37356703 missense probably damaging 1.00
R1731:Pcdhb8 UTSW 18 37355838 missense probably damaging 1.00
R1908:Pcdhb8 UTSW 18 37355962 missense possibly damaging 0.84
R1909:Pcdhb8 UTSW 18 37355962 missense possibly damaging 0.84
R2215:Pcdhb8 UTSW 18 37357074 missense probably damaging 0.98
R3080:Pcdhb8 UTSW 18 37356166 missense probably damaging 1.00
R4394:Pcdhb8 UTSW 18 37356882 missense probably damaging 1.00
R4799:Pcdhb8 UTSW 18 37355653 missense probably damaging 1.00
R4845:Pcdhb8 UTSW 18 37356718 missense probably benign 0.43
R4879:Pcdhb8 UTSW 18 37356166 missense probably damaging 1.00
R4941:Pcdhb8 UTSW 18 37356006 missense probably benign 0.03
R5086:Pcdhb8 UTSW 18 37356106 missense probably damaging 1.00
R5416:Pcdhb8 UTSW 18 37356955 missense probably damaging 1.00
R5774:Pcdhb8 UTSW 18 37356685 missense probably damaging 1.00
R5898:Pcdhb8 UTSW 18 37357484 missense possibly damaging 0.92
R5935:Pcdhb8 UTSW 18 37356190 missense probably damaging 1.00
R6191:Pcdhb8 UTSW 18 37356226 missense probably benign
R6228:Pcdhb8 UTSW 18 37356984 missense probably benign 0.05
R6245:Pcdhb8 UTSW 18 37357169 missense possibly damaging 0.80
R6397:Pcdhb8 UTSW 18 37355463 nonsense probably null
R7469:Pcdhb8 UTSW 18 37355958 missense probably damaging 1.00
R7632:Pcdhb8 UTSW 18 37355595 missense probably benign 0.00
R8323:Pcdhb8 UTSW 18 37355423 missense probably benign 0.23
R8735:Pcdhb8 UTSW 18 37356922 missense possibly damaging 0.91
R8841:Pcdhb8 UTSW 18 37355646 missense probably benign 0.26
R8856:Pcdhb8 UTSW 18 37356723 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGGTGGCTAACCTGGCACAAG -3'
(R):5'- CATCTGAGCGACTGAGAGTAACGAC -3'

Sequencing Primer
(F):5'- TAACCTGGCACAAGATCTGG -3'
(R):5'- CTGAGAGTAACGACATGGAAATG -3'
Posted On2013-08-06