Incidental Mutation 'R8314:Mmp13'
ID641570
Institutional Source Beutler Lab
Gene Symbol Mmp13
Ensembl Gene ENSMUSG00000050578
Gene Namematrix metallopeptidase 13
SynonymsMMP-13, interstitial collagenase, Clg, Mmp1, Collagenase-3, collagenase-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R8314 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location7272514-7283331 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7272931 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 97 (C97Y)
Ref Sequence ENSEMBL: ENSMUSP00000015394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015394]
PDB Structure STRUCTURE OF RECOMBINANT MOUSE COLLAGENASE-3 (MMP-13) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000015394
AA Change: C97Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015394
Gene: ENSMUSG00000050578
AA Change: C97Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:PG_binding_1 33 92 5.3e-13 PFAM
ZnMc 110 269 3.76e-59 SMART
HX 291 333 9.62e-8 SMART
HX 335 378 9.91e-10 SMART
HX 383 430 2.52e-11 SMART
HX 432 472 1.81e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family that plays a role in wound healing, skeletal development and bone remodeling. The encoded protein is activated by the removal of an N-terminal activation peptide to generate a zinc-dependent endopeptidase enzyme that can cleave various native collagens, including types I - IV, X and XIV. Mice lacking the encoded protein display profound defects in growth plate cartilage as well as a delay in the endochondral bone development. Lack of the encoded protein also impairs the wound healing process due to reduced keratinocyte migration and vascular density at the wound site. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Jun 2015]
PHENOTYPE: Homozygous null mice display increased width of hypertrophic chondrocyte zone and increased trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,928 T84S probably benign Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930533K18Rik A G 10: 70,875,276 T76A noncoding transcript Het
Adgrl1 C T 8: 83,938,389 T1235I probably damaging Het
Ak4 C T 4: 101,463,585 T197M possibly damaging Het
Alox12e T C 11: 70,316,172 M603V possibly damaging Het
Ap3d1 A T 10: 80,723,539 I267N possibly damaging Het
Arhgef2 T A 3: 88,621,293 I12N probably benign Het
Asnsd1 A T 1: 53,346,655 M520K probably damaging Het
B3galt5 T C 16: 96,315,449 L94P probably damaging Het
Birc3 T C 9: 7,872,941 probably benign Het
Cd177 T C 7: 24,750,588 S541G probably benign Het
Cdh8 T C 8: 99,171,379 D434G probably damaging Het
Cdkn3 A T 14: 46,769,873 silent Het
Ciita A T 16: 10,510,988 R379W probably damaging Het
Cntrl T A 2: 35,175,143 M2153K probably benign Het
Csmd1 A T 8: 16,158,244 D1232E probably benign Het
Cyp4a30b A C 4: 115,458,338 H252P probably benign Het
Dad1 G A 14: 54,253,812 R11W probably damaging Het
Ddit3 A G 10: 127,295,721 probably null Het
Dusp22 G A 13: 30,708,931 probably benign Het
Dzank1 A G 2: 144,502,958 L293P probably damaging Het
Edf1 A G 2: 25,557,965 D5G probably damaging Het
Ep400 T A 5: 110,755,753 M327L unknown Het
Fam135a A T 1: 24,021,921 H1341Q possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam189b T C 3: 89,188,146 probably null Het
Fbxl3 C T 14: 103,089,440 V169I probably benign Het
Gm4787 A G 12: 81,379,135 L83P probably damaging Het
Habp4 A G 13: 64,184,751 E392G probably damaging Het
Hspg2 C A 4: 137,539,675 P1997Q probably benign Het
Ints9 T C 14: 65,029,030 S444P probably damaging Het
Kif18b G A 11: 102,913,074 S420L probably benign Het
Klhl17 T A 4: 156,234,013 M51L probably benign Het
Kmt2b C T 7: 30,578,922 E1555K probably damaging Het
Malrd1 T A 2: 15,752,832 D972E unknown Het
Mapk8ip3 A T 17: 24,901,774 S805R probably benign Het
Moxd1 T A 10: 24,252,540 N163K possibly damaging Het
Nbea T C 3: 56,009,251 I863V probably damaging Het
Nectin4 A G 1: 171,384,727 T298A probably benign Het
Net1 T C 13: 3,912,672 probably benign Het
Ntn1 T C 11: 68,385,624 D166G probably damaging Het
Olfr1137 A G 2: 87,711,202 F235L probably benign Het
Olfr140 T C 2: 90,052,097 T76A probably benign Het
Olfr391-ps T G 11: 73,799,742 N5T noncoding transcript Het
Olfr620 T C 7: 103,612,047 Q102R probably damaging Het
Olfr948 A G 9: 39,319,305 F103S probably damaging Het
Opa3 C A 7: 19,245,015 A135E possibly damaging Het
Osbpl5 T C 7: 143,695,096 I608V probably benign Het
Phc1 A C 6: 122,320,978 S782R unknown Het
Pip5k1b T A 19: 24,355,199 T374S probably benign Het
Prkaa1 A G 15: 5,178,873 S541G probably damaging Het
Ptpn20 A G 14: 33,622,547 N143D possibly damaging Het
Rabep1 A G 11: 70,893,660 D207G possibly damaging Het
Rbbp8 G A 18: 11,720,625 M296I probably benign Het
Recql4 C A 15: 76,710,180 R46L probably damaging Het
Scgb2b18 T C 7: 33,173,157 I74M probably benign Het
Shc4 A G 2: 125,655,616 I391T possibly damaging Het
Slc38a4 A G 15: 97,010,309 F184L probably benign Het
Slc7a6 A G 8: 106,168,958 probably benign Het
Smim13 G T 13: 41,272,634 G49* probably null Het
Tbc1d19 A G 5: 53,897,047 D459G probably damaging Het
Tnpo1 T C 13: 98,884,625 N82S possibly damaging Het
Tpp2 G A 1: 43,934,227 V47I probably benign Het
Umodl1 G T 17: 30,984,832 A540S probably damaging Het
Vmn2r83 G A 10: 79,481,479 V519I possibly damaging Het
Zfp641 T C 15: 98,290,583 I139V probably damaging Het
Zfyve21 A T 12: 111,823,281 I60F probably benign Het
Other mutations in Mmp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Mmp13 APN 9 7278974 splice site probably benign
IGL02027:Mmp13 APN 9 7272955 missense probably damaging 1.00
IGL02320:Mmp13 APN 9 7278941 missense probably benign 0.00
R0143:Mmp13 UTSW 9 7276558 missense probably damaging 1.00
R0417:Mmp13 UTSW 9 7276602 missense probably benign
R0505:Mmp13 UTSW 9 7272929 missense probably damaging 1.00
R0624:Mmp13 UTSW 9 7280221 missense possibly damaging 0.69
R0632:Mmp13 UTSW 9 7274032 missense probably damaging 1.00
R0632:Mmp13 UTSW 9 7282077 missense possibly damaging 0.74
R1102:Mmp13 UTSW 9 7272952 missense possibly damaging 0.55
R1387:Mmp13 UTSW 9 7282033 missense possibly damaging 0.60
R1478:Mmp13 UTSW 9 7272892 missense probably damaging 1.00
R1669:Mmp13 UTSW 9 7277926 missense probably benign 0.01
R4647:Mmp13 UTSW 9 7274233 missense probably damaging 1.00
R4648:Mmp13 UTSW 9 7274233 missense probably damaging 1.00
R4668:Mmp13 UTSW 9 7272580 missense possibly damaging 0.54
R4827:Mmp13 UTSW 9 7278880 missense possibly damaging 0.68
R4898:Mmp13 UTSW 9 7272953 missense probably benign 0.10
R5780:Mmp13 UTSW 9 7278952 missense possibly damaging 0.76
R5946:Mmp13 UTSW 9 7276580 missense probably damaging 1.00
R5996:Mmp13 UTSW 9 7274269 missense probably damaging 1.00
R6102:Mmp13 UTSW 9 7276688 missense probably benign 0.07
R6693:Mmp13 UTSW 9 7280245 missense probably benign 0.00
R6789:Mmp13 UTSW 9 7272781 missense probably benign 0.00
R7310:Mmp13 UTSW 9 7280880 missense possibly damaging 0.60
R7728:Mmp13 UTSW 9 7274004 missense probably benign
R8041:Mmp13 UTSW 9 7280865 missense probably benign 0.13
R8324:Mmp13 UTSW 9 7276636 missense possibly damaging 0.75
R8684:Mmp13 UTSW 9 7282089 missense possibly damaging 0.51
R8755:Mmp13 UTSW 9 7277996 missense possibly damaging 0.51
T0722:Mmp13 UTSW 9 7280857 missense possibly damaging 0.67
Z1177:Mmp13 UTSW 9 7277953 missense probably damaging 1.00
Z1177:Mmp13 UTSW 9 7280200 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTGTAGTGCATTTCTCAAATCCC -3'
(R):5'- AGCTAATTCTGAACCGAACCTC -3'

Sequencing Primer
(F):5'- CAAATCCCTATTCTCTTAAAAGCTGG -3'
(R):5'- TCCAATTAACTACTCCAGGCC -3'
Posted On2020-07-28