Incidental Mutation 'R8314:Moxd1'
ID641574
Institutional Source Beutler Lab
Gene Symbol Moxd1
Ensembl Gene ENSMUSG00000020000
Gene Namemonooxygenase, DBH-like 1
Synonyms3230402N08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8314 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location24223517-24302790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24252540 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 163 (N163K)
Ref Sequence ENSEMBL: ENSMUSP00000093460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095784]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095784
AA Change: N163K

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093460
Gene: ENSMUSG00000020000
AA Change: N163K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DoH 59 148 7.89e-15 SMART
Pfam:Cu2_monooxygen 186 315 2.7e-50 PFAM
Pfam:Cu2_monoox_C 334 491 2.1e-48 PFAM
low complexity region 602 613 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,928 T84S probably benign Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930533K18Rik A G 10: 70,875,276 T76A noncoding transcript Het
Adgrl1 C T 8: 83,938,389 T1235I probably damaging Het
Ak4 C T 4: 101,463,585 T197M possibly damaging Het
Alox12e T C 11: 70,316,172 M603V possibly damaging Het
Ap3d1 A T 10: 80,723,539 I267N possibly damaging Het
Arhgef2 T A 3: 88,621,293 I12N probably benign Het
Asnsd1 A T 1: 53,346,655 M520K probably damaging Het
B3galt5 T C 16: 96,315,449 L94P probably damaging Het
Birc3 T C 9: 7,872,941 probably benign Het
Cd177 T C 7: 24,750,588 S541G probably benign Het
Cdh8 T C 8: 99,171,379 D434G probably damaging Het
Ciita A T 16: 10,510,988 R379W probably damaging Het
Cntrl T A 2: 35,175,143 M2153K probably benign Het
Csmd1 A T 8: 16,158,244 D1232E probably benign Het
Cyp4a30b A C 4: 115,458,338 H252P probably benign Het
Dad1 G A 14: 54,253,812 R11W probably damaging Het
Ddit3 A G 10: 127,295,721 probably null Het
Dzank1 A G 2: 144,502,958 L293P probably damaging Het
Edf1 A G 2: 25,557,965 D5G probably damaging Het
Ep400 T A 5: 110,755,753 M327L unknown Het
Fam135a A T 1: 24,021,921 H1341Q possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam189b T C 3: 89,188,146 probably null Het
Fbxl3 C T 14: 103,089,440 V169I probably benign Het
Gm4787 A G 12: 81,379,135 L83P probably damaging Het
Habp4 A G 13: 64,184,751 E392G probably damaging Het
Hspg2 C A 4: 137,539,675 P1997Q probably benign Het
Ints9 T C 14: 65,029,030 S444P probably damaging Het
Kif18b G A 11: 102,913,074 S420L probably benign Het
Klhl17 T A 4: 156,234,013 M51L probably benign Het
Kmt2b C T 7: 30,578,922 E1555K probably damaging Het
Malrd1 T A 2: 15,752,832 D972E unknown Het
Mapk8ip3 A T 17: 24,901,774 S805R probably benign Het
Mmp13 G A 9: 7,272,931 C97Y probably damaging Het
Nbea T C 3: 56,009,251 I863V probably damaging Het
Nectin4 A G 1: 171,384,727 T298A probably benign Het
Ntn1 T C 11: 68,385,624 D166G probably damaging Het
Olfr1137 A G 2: 87,711,202 F235L probably benign Het
Olfr140 T C 2: 90,052,097 T76A probably benign Het
Olfr391-ps T G 11: 73,799,742 N5T noncoding transcript Het
Olfr620 T C 7: 103,612,047 Q102R probably damaging Het
Olfr948 A G 9: 39,319,305 F103S probably damaging Het
Opa3 C A 7: 19,245,015 A135E possibly damaging Het
Osbpl5 T C 7: 143,695,096 I608V probably benign Het
Phc1 A C 6: 122,320,978 S782R unknown Het
Pip5k1b T A 19: 24,355,199 T374S probably benign Het
Prkaa1 A G 15: 5,178,873 S541G probably damaging Het
Ptpn20 A G 14: 33,622,547 N143D possibly damaging Het
Rabep1 A G 11: 70,893,660 D207G possibly damaging Het
Rbbp8 G A 18: 11,720,625 M296I probably benign Het
Recql4 C A 15: 76,710,180 R46L probably damaging Het
Scgb2b18 T C 7: 33,173,157 I74M probably benign Het
Shc4 A G 2: 125,655,616 I391T possibly damaging Het
Slc38a4 A G 15: 97,010,309 F184L probably benign Het
Smim13 G T 13: 41,272,634 G49* probably null Het
Tbc1d19 A G 5: 53,897,047 D459G probably damaging Het
Tnpo1 T C 13: 98,884,625 N82S possibly damaging Het
Tpp2 G A 1: 43,934,227 V47I probably benign Het
Umodl1 G T 17: 30,984,832 A540S probably damaging Het
Vmn2r83 G A 10: 79,481,479 V519I possibly damaging Het
Zfp641 T C 15: 98,290,583 I139V probably damaging Het
Zfyve21 A T 12: 111,823,281 I60F probably benign Het
Other mutations in Moxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Moxd1 APN 10 24279864 missense probably damaging 1.00
IGL00227:Moxd1 APN 10 24282593 missense probably damaging 1.00
IGL00331:Moxd1 APN 10 24282555 splice site probably benign
IGL01074:Moxd1 APN 10 24279384 missense probably benign 0.45
IGL01462:Moxd1 APN 10 24244388 critical splice donor site probably null
IGL01777:Moxd1 APN 10 24252596 missense probably benign 0.00
IGL02051:Moxd1 APN 10 24253018 splice site probably null
IGL02272:Moxd1 APN 10 24282700 nonsense probably null
IGL02343:Moxd1 APN 10 24279864 missense probably damaging 1.00
IGL02425:Moxd1 APN 10 24279436 missense probably benign 0.01
IGL02448:Moxd1 APN 10 24282719 missense probably damaging 0.99
IGL02452:Moxd1 APN 10 24282752 missense probably damaging 1.00
IGL03301:Moxd1 APN 10 24279484 missense probably damaging 0.99
R0631:Moxd1 UTSW 10 24252954 missense probably damaging 1.00
R1436:Moxd1 UTSW 10 24244358 missense probably damaging 1.00
R1484:Moxd1 UTSW 10 24223860 missense probably damaging 1.00
R1574:Moxd1 UTSW 10 24300319 missense probably damaging 1.00
R1574:Moxd1 UTSW 10 24300319 missense probably damaging 1.00
R1713:Moxd1 UTSW 10 24281496 missense probably damaging 1.00
R1954:Moxd1 UTSW 10 24279883 missense probably benign 0.17
R3115:Moxd1 UTSW 10 24301531 nonsense probably null
R3116:Moxd1 UTSW 10 24301531 nonsense probably null
R5183:Moxd1 UTSW 10 24279547 critical splice donor site probably null
R5183:Moxd1 UTSW 10 24287136 missense probably damaging 1.00
R5322:Moxd1 UTSW 10 24244253 missense possibly damaging 0.88
R5728:Moxd1 UTSW 10 24223683 missense possibly damaging 0.92
R5824:Moxd1 UTSW 10 24287097 missense probably damaging 1.00
R6158:Moxd1 UTSW 10 24284777 missense probably damaging 1.00
R6322:Moxd1 UTSW 10 24284811 missense probably damaging 1.00
R6662:Moxd1 UTSW 10 24284760 missense probably damaging 1.00
R6827:Moxd1 UTSW 10 24279850 missense probably benign 0.29
R6928:Moxd1 UTSW 10 24300288 missense probably damaging 1.00
R7048:Moxd1 UTSW 10 24281476 missense probably damaging 1.00
R7320:Moxd1 UTSW 10 24301465 missense probably benign 0.05
R7736:Moxd1 UTSW 10 24282710 missense probably damaging 1.00
R8060:Moxd1 UTSW 10 24301612 missense unknown
R8073:Moxd1 UTSW 10 24252950 missense probably damaging 1.00
R8089:Moxd1 UTSW 10 24281519 missense probably benign 0.43
R8255:Moxd1 UTSW 10 24223802 missense probably benign 0.02
X0063:Moxd1 UTSW 10 24252500 missense probably benign 0.18
Z1177:Moxd1 UTSW 10 24284804 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAATCAACTCCCTGGGTATTC -3'
(R):5'- GCAAGCAGTCTTATACACTTTTGG -3'

Sequencing Primer
(F):5'- ATTTCTTCATTCCTATGTGCTGC -3'
(R):5'- GCAGTCTTATACACTTTTGGTTAACC -3'
Posted On2020-07-28