Incidental Mutation 'R0104:Kcnv2'
ID64158
Institutional Source Beutler Lab
Gene Symbol Kcnv2
Ensembl Gene ENSMUSG00000047298
Gene Namepotassium channel, subfamily V, member 2
SynonymsKV11.1
MMRRC Submission 038390-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0104 (G1)
Quality Score87
Status Not validated
Chromosome19
Chromosomal Location27322588-27337179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27323219 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 157 (Y157H)
Ref Sequence ENSEMBL: ENSMUSP00000055091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056708]
Predicted Effect probably damaging
Transcript: ENSMUST00000056708
AA Change: Y157H

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055091
Gene: ENSMUSG00000047298
AA Change: Y157H

DomainStartEndE-ValueType
low complexity region 64 79 N/A INTRINSIC
Pfam:BTB_2 107 206 3.1e-22 PFAM
low complexity region 225 240 N/A INTRINSIC
Pfam:Ion_trans 269 521 2.2e-39 PFAM
Pfam:PKD_channel 305 516 2.5e-7 PFAM
Pfam:Ion_trans_2 430 515 2.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This member is identified as a 'silent subunit', and it does not form homomultimers, but forms heteromultimers with several other subfamily members. Through obligatory heteromerization, it exerts a function-altering effect on other potassium channel subunits. This protein is strongly expressed in pancreas and has a weaker expression in several other tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional ready allele are viable, fertile, and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dnah5 A T 15: 28,453,353 E4423D possibly damaging Het
Fsip2 A T 2: 82,978,973 T1879S possibly damaging Het
Gm136 G T 4: 34,746,593 H139Q possibly damaging Het
Ifrd2 T A 9: 107,587,917 L10H probably damaging Het
Itpr3 C A 17: 27,095,992 H704Q probably benign Het
Kcng1 A G 2: 168,269,046 I66T probably damaging Het
Leng8 A G 7: 4,143,808 D443G probably damaging Het
Mlst8 T C 17: 24,476,117 N264S possibly damaging Het
Pcdhb8 A G 18: 37,355,665 E132G probably benign Het
Pmpcb C G 5: 21,746,038 S266* probably null Het
Prmt7 T C 8: 106,237,350 I292T probably damaging Het
Rif1 T C 2: 52,110,092 L1186S possibly damaging Het
Sox30 A C 11: 45,981,314 E332A possibly damaging Het
Taf2 T C 15: 55,038,338 D820G probably benign Het
Tas2r120 T A 6: 132,657,846 probably null Het
Zfp655 T C 5: 145,244,015 S228P probably damaging Het
Zfyve9 C A 4: 108,718,163 D574Y probably damaging Het
Other mutations in Kcnv2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03157:Kcnv2 APN 19 27323966 missense probably damaging 1.00
R0319:Kcnv2 UTSW 19 27324024 missense probably benign 0.25
R2852:Kcnv2 UTSW 19 27323096 missense probably benign 0.13
R4578:Kcnv2 UTSW 19 27323594 missense probably benign 0.01
R4702:Kcnv2 UTSW 19 27323567 missense probably damaging 1.00
R4842:Kcnv2 UTSW 19 27323790 missense probably damaging 1.00
R4935:Kcnv2 UTSW 19 27322932 missense probably damaging 1.00
R6305:Kcnv2 UTSW 19 27323837 missense probably benign 0.01
R6577:Kcnv2 UTSW 19 27324020 missense possibly damaging 0.46
R6974:Kcnv2 UTSW 19 27333882 missense probably benign
R7113:Kcnv2 UTSW 19 27324048 missense probably damaging 1.00
R7289:Kcnv2 UTSW 19 27333684 missense probably damaging 1.00
R7838:Kcnv2 UTSW 19 27322932 missense probably damaging 1.00
R7936:Kcnv2 UTSW 19 27322767 missense probably benign 0.04
R8528:Kcnv2 UTSW 19 27322987 missense probably benign 0.00
R8854:Kcnv2 UTSW 19 27333858 missense probably benign 0.01
Z1176:Kcnv2 UTSW 19 27323438 missense probably benign 0.11
Z1177:Kcnv2 UTSW 19 27323241 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCACGCTGAAAGTGAACGTAGG -3'
(R):5'- CCATAGAAGCGCATGTCCCGAAAG -3'

Sequencing Primer
(F):5'- TAGGCGGCCACAGCTATC -3'
(R):5'- GATCTTCAGTTGCTCGCTCAG -3'
Posted On2013-08-06