Incidental Mutation 'R8314:Gm4787'
ID 641585
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Name predicted gene 4787
Synonyms
MMRRC Submission 067719-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8314 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 81423765-81426238 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81425909 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 83 (L83P)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
AlphaFold B2RUD9
Predicted Effect probably damaging
Transcript: ENSMUST00000062182
AA Change: L83P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: L83P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,777,993 (GRCm39) T84S probably benign Het
4930533K18Rik A G 10: 70,711,106 (GRCm39) T76A noncoding transcript Het
Adgrl1 C T 8: 84,665,018 (GRCm39) T1235I probably damaging Het
Ak4 C T 4: 101,320,782 (GRCm39) T197M possibly damaging Het
Alkal2 G T 12: 30,934,850 (GRCm39) G23V probably damaging Het
Alox12e T C 11: 70,206,998 (GRCm39) M603V possibly damaging Het
Ap3d1 A T 10: 80,559,373 (GRCm39) I267N possibly damaging Het
Arhgef2 T A 3: 88,528,600 (GRCm39) I12N probably benign Het
Asnsd1 A T 1: 53,385,814 (GRCm39) M520K probably damaging Het
B3galt5 T C 16: 96,116,649 (GRCm39) L94P probably damaging Het
Birc2 T C 9: 7,872,942 (GRCm39) probably benign Het
Cd177 T C 7: 24,450,013 (GRCm39) S541G probably benign Het
Cdh8 T C 8: 99,898,011 (GRCm39) D434G probably damaging Het
Cdkn3 A T 14: 47,007,330 (GRCm39) silent Het
Ciita A T 16: 10,328,852 (GRCm39) R379W probably damaging Het
Cntrl T A 2: 35,065,155 (GRCm39) M2153K probably benign Het
Csmd1 A T 8: 16,208,258 (GRCm39) D1232E probably benign Het
Cyp4a30b A C 4: 115,315,535 (GRCm39) H252P probably benign Het
Dad1 G A 14: 54,491,269 (GRCm39) R11W probably damaging Het
Ddit3 A G 10: 127,131,590 (GRCm39) probably null Het
Dusp22 G A 13: 30,892,914 (GRCm39) probably benign Het
Dzank1 A G 2: 144,344,878 (GRCm39) L293P probably damaging Het
Edf1 A G 2: 25,447,977 (GRCm39) D5G probably damaging Het
Entrep3 T C 3: 89,095,453 (GRCm39) probably null Het
Ep400 T A 5: 110,903,619 (GRCm39) M327L unknown Het
Fam135a A T 1: 24,061,002 (GRCm39) H1341Q possibly damaging Het
Fbxl3 C T 14: 103,326,876 (GRCm39) V169I probably benign Het
Habp4 A G 13: 64,332,565 (GRCm39) E392G probably damaging Het
Hspg2 C A 4: 137,266,986 (GRCm39) P1997Q probably benign Het
Ints9 T C 14: 65,266,479 (GRCm39) S444P probably damaging Het
Kif18b G A 11: 102,803,900 (GRCm39) S420L probably benign Het
Klhl17 T A 4: 156,318,470 (GRCm39) M51L probably benign Het
Kmt2b C T 7: 30,278,347 (GRCm39) E1555K probably damaging Het
Malrd1 T A 2: 15,757,643 (GRCm39) D972E unknown Het
Mapk8ip3 A T 17: 25,120,748 (GRCm39) S805R probably benign Het
Mmp13 G A 9: 7,272,931 (GRCm39) C97Y probably damaging Het
Moxd1 T A 10: 24,128,438 (GRCm39) N163K possibly damaging Het
Nbea T C 3: 55,916,672 (GRCm39) I863V probably damaging Het
Nectin4 A G 1: 171,212,295 (GRCm39) T298A probably benign Het
Net1 T C 13: 3,962,672 (GRCm39) probably benign Het
Ntn1 T C 11: 68,276,450 (GRCm39) D166G probably damaging Het
Opa3 C A 7: 18,978,940 (GRCm39) A135E possibly damaging Het
Or1e31 T G 11: 73,690,568 (GRCm39) N5T noncoding transcript Het
Or4c3d T C 2: 89,882,441 (GRCm39) T76A probably benign Het
Or51v14 T C 7: 103,261,254 (GRCm39) Q102R probably damaging Het
Or5w14 A G 2: 87,541,546 (GRCm39) F235L probably benign Het
Or8g30 A G 9: 39,230,601 (GRCm39) F103S probably damaging Het
Osbpl5 T C 7: 143,248,833 (GRCm39) I608V probably benign Het
Phc1 A C 6: 122,297,937 (GRCm39) S782R unknown Het
Phf8-ps C A 17: 33,286,038 (GRCm39) A255S probably benign Het
Pip5k1b T A 19: 24,332,563 (GRCm39) T374S probably benign Het
Prkaa1 A G 15: 5,208,354 (GRCm39) S541G probably damaging Het
Ptpn20 A G 14: 33,344,504 (GRCm39) N143D possibly damaging Het
Rabep1 A G 11: 70,784,486 (GRCm39) D207G possibly damaging Het
Rbbp8 G A 18: 11,853,682 (GRCm39) M296I probably benign Het
Recql4 C A 15: 76,594,380 (GRCm39) R46L probably damaging Het
Scgb2b18 T C 7: 32,872,582 (GRCm39) I74M probably benign Het
Shc4 A G 2: 125,497,536 (GRCm39) I391T possibly damaging Het
Slc38a4 A G 15: 96,908,190 (GRCm39) F184L probably benign Het
Slc7a6 A G 8: 106,895,590 (GRCm39) probably benign Het
Smim13 G T 13: 41,426,110 (GRCm39) G49* probably null Het
Tbc1d19 A G 5: 54,054,389 (GRCm39) D459G probably damaging Het
Tnpo1 T C 13: 99,021,133 (GRCm39) N82S possibly damaging Het
Tpp2 G A 1: 43,973,387 (GRCm39) V47I probably benign Het
Umodl1 G T 17: 31,203,806 (GRCm39) A540S probably damaging Het
Vmn2r83 G A 10: 79,317,313 (GRCm39) V519I possibly damaging Het
Zfp641 T C 15: 98,188,464 (GRCm39) I139V probably damaging Het
Zfyve21 A T 12: 111,789,715 (GRCm39) I60F probably benign Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81,423,948 (GRCm39) missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81,424,218 (GRCm39) missense probably benign 0.36
IGL02193:Gm4787 APN 12 81,425,302 (GRCm39) missense probably benign 0.02
IGL02623:Gm4787 APN 12 81,425,502 (GRCm39) missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81,425,543 (GRCm39) missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81,424,826 (GRCm39) missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81,425,948 (GRCm39) missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
PIT4362001:Gm4787 UTSW 12 81,423,949 (GRCm39) missense probably benign
R0070:Gm4787 UTSW 12 81,425,840 (GRCm39) missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81,424,521 (GRCm39) nonsense probably null
R0220:Gm4787 UTSW 12 81,425,422 (GRCm39) missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81,425,708 (GRCm39) missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81,425,086 (GRCm39) missense probably benign 0.03
R1761:Gm4787 UTSW 12 81,423,950 (GRCm39) missense probably benign 0.02
R1809:Gm4787 UTSW 12 81,425,303 (GRCm39) missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81,425,108 (GRCm39) missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81,425,108 (GRCm39) missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81,425,544 (GRCm39) missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81,425,694 (GRCm39) missense probably benign 0.39
R2112:Gm4787 UTSW 12 81,424,607 (GRCm39) missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81,425,336 (GRCm39) missense probably benign 0.03
R2151:Gm4787 UTSW 12 81,423,993 (GRCm39) missense probably benign 0.00
R2152:Gm4787 UTSW 12 81,423,993 (GRCm39) missense probably benign 0.00
R2342:Gm4787 UTSW 12 81,425,532 (GRCm39) missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81,425,911 (GRCm39) missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81,425,132 (GRCm39) missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81,425,987 (GRCm39) missense probably benign 0.17
R4748:Gm4787 UTSW 12 81,424,830 (GRCm39) missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81,425,141 (GRCm39) missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81,425,612 (GRCm39) missense probably benign 0.03
R4960:Gm4787 UTSW 12 81,426,090 (GRCm39) missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81,424,403 (GRCm39) missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5029:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5031:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5098:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5099:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5100:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5101:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5135:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5152:Gm4787 UTSW 12 81,425,451 (GRCm39) missense probably benign 0.02
R5180:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5220:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5257:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5258:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5297:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5324:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5325:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5355:Gm4787 UTSW 12 81,424,239 (GRCm39) nonsense probably null
R5364:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5396:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5397:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5398:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5514:Gm4787 UTSW 12 81,425,102 (GRCm39) missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5666:Gm4787 UTSW 12 81,424,805 (GRCm39) missense probably benign 0.23
R5670:Gm4787 UTSW 12 81,424,805 (GRCm39) missense probably benign 0.23
R5787:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R5788:Gm4787 UTSW 12 81,424,604 (GRCm39) missense probably benign 0.01
R6354:Gm4787 UTSW 12 81,424,755 (GRCm39) missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81,425,974 (GRCm39) missense probably benign 0.04
R7120:Gm4787 UTSW 12 81,425,260 (GRCm39) missense probably benign 0.00
R7237:Gm4787 UTSW 12 81,424,442 (GRCm39) missense probably damaging 0.99
R7937:Gm4787 UTSW 12 81,424,679 (GRCm39) missense probably benign 0.01
R8022:Gm4787 UTSW 12 81,424,494 (GRCm39) missense possibly damaging 0.94
R8140:Gm4787 UTSW 12 81,424,925 (GRCm39) missense probably benign 0.00
R8480:Gm4787 UTSW 12 81,424,280 (GRCm39) missense probably damaging 1.00
R8498:Gm4787 UTSW 12 81,425,840 (GRCm39) missense probably damaging 1.00
R8515:Gm4787 UTSW 12 81,424,043 (GRCm39) missense probably benign 0.00
R9103:Gm4787 UTSW 12 81,425,489 (GRCm39) missense probably benign 0.06
R9457:Gm4787 UTSW 12 81,426,020 (GRCm39) missense probably damaging 1.00
R9557:Gm4787 UTSW 12 81,426,074 (GRCm39) nonsense probably null
R9608:Gm4787 UTSW 12 81,425,086 (GRCm39) missense probably benign 0.03
V7580:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
V7581:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
V7582:Gm4787 UTSW 12 81,424,341 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCATGCCTTTCAGACCTCCAG -3'
(R):5'- ACCACCTACCTGGACTTTGG -3'

Sequencing Primer
(F):5'- TCAGACCTCCAGTGCAGGTATCTAG -3'
(R):5'- ACTTTGGCCCTCCTGAGAG -3'
Posted On 2020-07-28