Incidental Mutation 'R8314:Recql4'
ID641595
Institutional Source Beutler Lab
Gene Symbol Recql4
Ensembl Gene ENSMUSG00000033762
Gene NameRecQ protein-like 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8314 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76703553-76710548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76710180 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 46 (R46L)
Ref Sequence ENSEMBL: ENSMUSP00000044363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036423] [ENSMUST00000036852] [ENSMUST00000127208] [ENSMUST00000136840] [ENSMUST00000137649] [ENSMUST00000142610] [ENSMUST00000155225] [ENSMUST00000155735]
Predicted Effect probably benign
Transcript: ENSMUST00000036423
SMART Domains Protein: ENSMUSP00000049466
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000036852
AA Change: R46L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762
AA Change: R46L

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127208
SMART Domains Protein: ENSMUSP00000114921
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136840
SMART Domains Protein: ENSMUSP00000119670
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137649
SMART Domains Protein: ENSMUSP00000121982
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142610
SMART Domains Protein: ENSMUSP00000117780
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155225
Predicted Effect probably benign
Transcript: ENSMUST00000155735
SMART Domains Protein: ENSMUSP00000115446
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous loss of exons 5-8 causes embryonic death. Deletion of exon 13 causes neo- and postnatal lethality, stunted growth, skin, hair and bone defects, tissue hypoplasia and tooth dysgenesis. Mice lacking exons 9-13 show palate and limb defects, aneuploidy, poikiloderma and cancer predisposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,928 T84S probably benign Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930533K18Rik A G 10: 70,875,276 T76A noncoding transcript Het
Adgrl1 C T 8: 83,938,389 T1235I probably damaging Het
Ak4 C T 4: 101,463,585 T197M possibly damaging Het
Alox12e T C 11: 70,316,172 M603V possibly damaging Het
Ap3d1 A T 10: 80,723,539 I267N possibly damaging Het
Arhgef2 T A 3: 88,621,293 I12N probably benign Het
Asnsd1 A T 1: 53,346,655 M520K probably damaging Het
B3galt5 T C 16: 96,315,449 L94P probably damaging Het
Birc3 T C 9: 7,872,941 probably benign Het
Cd177 T C 7: 24,750,588 S541G probably benign Het
Cdh8 T C 8: 99,171,379 D434G probably damaging Het
Ciita A T 16: 10,510,988 R379W probably damaging Het
Cntrl T A 2: 35,175,143 M2153K probably benign Het
Csmd1 A T 8: 16,158,244 D1232E probably benign Het
Cyp4a30b A C 4: 115,458,338 H252P probably benign Het
Dad1 G A 14: 54,253,812 R11W probably damaging Het
Ddit3 A G 10: 127,295,721 probably null Het
Dzank1 A G 2: 144,502,958 L293P probably damaging Het
Edf1 A G 2: 25,557,965 D5G probably damaging Het
Ep400 T A 5: 110,755,753 M327L unknown Het
Fam135a A T 1: 24,021,921 H1341Q possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam189b T C 3: 89,188,146 probably null Het
Fbxl3 C T 14: 103,089,440 V169I probably benign Het
Gm4787 A G 12: 81,379,135 L83P probably damaging Het
Habp4 A G 13: 64,184,751 E392G probably damaging Het
Hspg2 C A 4: 137,539,675 P1997Q probably benign Het
Ints9 T C 14: 65,029,030 S444P probably damaging Het
Kif18b G A 11: 102,913,074 S420L probably benign Het
Klhl17 T A 4: 156,234,013 M51L probably benign Het
Kmt2b C T 7: 30,578,922 E1555K probably damaging Het
Malrd1 T A 2: 15,752,832 D972E unknown Het
Mapk8ip3 A T 17: 24,901,774 S805R probably benign Het
Mmp13 G A 9: 7,272,931 C97Y probably damaging Het
Moxd1 T A 10: 24,252,540 N163K possibly damaging Het
Nbea T C 3: 56,009,251 I863V probably damaging Het
Nectin4 A G 1: 171,384,727 T298A probably benign Het
Ntn1 T C 11: 68,385,624 D166G probably damaging Het
Olfr1137 A G 2: 87,711,202 F235L probably benign Het
Olfr140 T C 2: 90,052,097 T76A probably benign Het
Olfr391-ps T G 11: 73,799,742 N5T noncoding transcript Het
Olfr620 T C 7: 103,612,047 Q102R probably damaging Het
Olfr948 A G 9: 39,319,305 F103S probably damaging Het
Opa3 C A 7: 19,245,015 A135E possibly damaging Het
Osbpl5 T C 7: 143,695,096 I608V probably benign Het
Phc1 A C 6: 122,320,978 S782R unknown Het
Pip5k1b T A 19: 24,355,199 T374S probably benign Het
Prkaa1 A G 15: 5,178,873 S541G probably damaging Het
Ptpn20 A G 14: 33,622,547 N143D possibly damaging Het
Rabep1 A G 11: 70,893,660 D207G possibly damaging Het
Rbbp8 G A 18: 11,720,625 M296I probably benign Het
Scgb2b18 T C 7: 33,173,157 I74M probably benign Het
Shc4 A G 2: 125,655,616 I391T possibly damaging Het
Slc38a4 A G 15: 97,010,309 F184L probably benign Het
Smim13 G T 13: 41,272,634 G49* probably null Het
Tbc1d19 A G 5: 53,897,047 D459G probably damaging Het
Tnpo1 T C 13: 98,884,625 N82S possibly damaging Het
Tpp2 G A 1: 43,934,227 V47I probably benign Het
Umodl1 G T 17: 30,984,832 A540S probably damaging Het
Vmn2r83 G A 10: 79,481,479 V519I possibly damaging Het
Zfp641 T C 15: 98,290,583 I139V probably damaging Het
Zfyve21 A T 12: 111,823,281 I60F probably benign Het
Other mutations in Recql4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Recql4 APN 15 76707336 missense possibly damaging 0.52
IGL01287:Recql4 APN 15 76709912 splice site probably benign
IGL01470:Recql4 APN 15 76708944 missense probably benign 0.40
IGL01809:Recql4 APN 15 76708870 nonsense probably null
IGL02094:Recql4 APN 15 76709517 missense probably benign 0.01
IGL02303:Recql4 APN 15 76708571 missense possibly damaging 0.64
IGL02702:Recql4 APN 15 76707285 missense probably damaging 1.00
IGL03086:Recql4 APN 15 76706268 missense probably benign 0.30
IGL03162:Recql4 APN 15 76706096 splice site probably null
ANU74:Recql4 UTSW 15 76705757 missense possibly damaging 0.47
F5770:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
R0688:Recql4 UTSW 15 76709809 splice site probably null
R1171:Recql4 UTSW 15 76704039 missense possibly damaging 0.94
R1348:Recql4 UTSW 15 76709211 missense probably benign 0.01
R1487:Recql4 UTSW 15 76708983 missense probably benign 0.11
R1547:Recql4 UTSW 15 76706311 missense probably damaging 0.99
R1917:Recql4 UTSW 15 76703837 nonsense probably null
R3813:Recql4 UTSW 15 76704494 missense possibly damaging 0.67
R4066:Recql4 UTSW 15 76705827 missense probably damaging 1.00
R4363:Recql4 UTSW 15 76706044 missense probably benign 0.07
R4387:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4388:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4700:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4701:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4923:Recql4 UTSW 15 76710181 missense probably damaging 1.00
R5075:Recql4 UTSW 15 76709544 missense probably damaging 1.00
R5103:Recql4 UTSW 15 76706756 missense probably damaging 1.00
R5226:Recql4 UTSW 15 76710129 missense probably benign
R5500:Recql4 UTSW 15 76705578 intron probably benign
R5547:Recql4 UTSW 15 76705794 nonsense probably null
R5824:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R5976:Recql4 UTSW 15 76709424 missense probably benign 0.01
R6086:Recql4 UTSW 15 76704587 missense probably damaging 0.96
R6756:Recql4 UTSW 15 76704859 missense probably benign 0.00
R7075:Recql4 UTSW 15 76706424 missense possibly damaging 0.95
R7086:Recql4 UTSW 15 76705553 missense unknown
R7449:Recql4 UTSW 15 76705565 missense unknown
R7653:Recql4 UTSW 15 76703782 missense probably benign 0.01
V7580:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7581:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7583:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AACTTCTGTGCTCCATGGAG -3'
(R):5'- TAAACTCACGTTCGGGCTG -3'

Sequencing Primer
(F):5'- GGCACGGCTGCAAAATGC -3'
(R):5'- TTCGGGCTGCCATGGAG -3'
Posted On2020-07-28