Incidental Mutation 'R8314:Rbbp8'
ID641603
Institutional Source Beutler Lab
Gene Symbol Rbbp8
Ensembl Gene ENSMUSG00000041238
Gene Nameretinoblastoma binding protein 8, endonuclease
Synonyms9930104E21Rik, CtIP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8314 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location11633276-11743207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11720625 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 296 (M296I)
Ref Sequence ENSEMBL: ENSMUSP00000046255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047322] [ENSMUST00000115861]
Predicted Effect probably benign
Transcript: ENSMUST00000047322
AA Change: M296I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000046255
Gene: ENSMUSG00000041238
AA Change: M296I

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 9.6e-61 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 790 854 8.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115861
AA Change: M296I

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111527
Gene: ENSMUSG00000041238
AA Change: M296I

DomainStartEndE-ValueType
Pfam:CtIP_N 20 139 5.2e-55 PFAM
PDB:2L4Z|A 639 675 3e-15 PDB
Pfam:SAE2 817 854 1.4e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die at E4.0 as blastocysts fail to enter S phase and arrest at G1, leading to elevated cell death. Heterozygous mutant mice display a shortened lifespan due to formation of multiple tumors, mostly large lymphomasof both B and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,928 T84S probably benign Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930533K18Rik A G 10: 70,875,276 T76A noncoding transcript Het
Adgrl1 C T 8: 83,938,389 T1235I probably damaging Het
Ak4 C T 4: 101,463,585 T197M possibly damaging Het
Alox12e T C 11: 70,316,172 M603V possibly damaging Het
Ap3d1 A T 10: 80,723,539 I267N possibly damaging Het
Arhgef2 T A 3: 88,621,293 I12N probably benign Het
Asnsd1 A T 1: 53,346,655 M520K probably damaging Het
B3galt5 T C 16: 96,315,449 L94P probably damaging Het
Birc3 T C 9: 7,872,941 probably benign Het
Cd177 T C 7: 24,750,588 S541G probably benign Het
Cdh8 T C 8: 99,171,379 D434G probably damaging Het
Ciita A T 16: 10,510,988 R379W probably damaging Het
Cntrl T A 2: 35,175,143 M2153K probably benign Het
Csmd1 A T 8: 16,158,244 D1232E probably benign Het
Cyp4a30b A C 4: 115,458,338 H252P probably benign Het
Dad1 G A 14: 54,253,812 R11W probably damaging Het
Ddit3 A G 10: 127,295,721 probably null Het
Dzank1 A G 2: 144,502,958 L293P probably damaging Het
Edf1 A G 2: 25,557,965 D5G probably damaging Het
Ep400 T A 5: 110,755,753 M327L unknown Het
Fam135a A T 1: 24,021,921 H1341Q possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam189b T C 3: 89,188,146 probably null Het
Fbxl3 C T 14: 103,089,440 V169I probably benign Het
Gm4787 A G 12: 81,379,135 L83P probably damaging Het
Habp4 A G 13: 64,184,751 E392G probably damaging Het
Hspg2 C A 4: 137,539,675 P1997Q probably benign Het
Ints9 T C 14: 65,029,030 S444P probably damaging Het
Kif18b G A 11: 102,913,074 S420L probably benign Het
Klhl17 T A 4: 156,234,013 M51L probably benign Het
Kmt2b C T 7: 30,578,922 E1555K probably damaging Het
Malrd1 T A 2: 15,752,832 D972E unknown Het
Mapk8ip3 A T 17: 24,901,774 S805R probably benign Het
Mmp13 G A 9: 7,272,931 C97Y probably damaging Het
Moxd1 T A 10: 24,252,540 N163K possibly damaging Het
Nbea T C 3: 56,009,251 I863V probably damaging Het
Nectin4 A G 1: 171,384,727 T298A probably benign Het
Ntn1 T C 11: 68,385,624 D166G probably damaging Het
Olfr1137 A G 2: 87,711,202 F235L probably benign Het
Olfr140 T C 2: 90,052,097 T76A probably benign Het
Olfr391-ps T G 11: 73,799,742 N5T noncoding transcript Het
Olfr620 T C 7: 103,612,047 Q102R probably damaging Het
Olfr948 A G 9: 39,319,305 F103S probably damaging Het
Opa3 C A 7: 19,245,015 A135E possibly damaging Het
Osbpl5 T C 7: 143,695,096 I608V probably benign Het
Phc1 A C 6: 122,320,978 S782R unknown Het
Pip5k1b T A 19: 24,355,199 T374S probably benign Het
Prkaa1 A G 15: 5,178,873 S541G probably damaging Het
Ptpn20 A G 14: 33,622,547 N143D possibly damaging Het
Rabep1 A G 11: 70,893,660 D207G possibly damaging Het
Recql4 C A 15: 76,710,180 R46L probably damaging Het
Scgb2b18 T C 7: 33,173,157 I74M probably benign Het
Shc4 A G 2: 125,655,616 I391T possibly damaging Het
Slc38a4 A G 15: 97,010,309 F184L probably benign Het
Smim13 G T 13: 41,272,634 G49* probably null Het
Tbc1d19 A G 5: 53,897,047 D459G probably damaging Het
Tnpo1 T C 13: 98,884,625 N82S possibly damaging Het
Tpp2 G A 1: 43,934,227 V47I probably benign Het
Umodl1 G T 17: 30,984,832 A540S probably damaging Het
Vmn2r83 G A 10: 79,481,479 V519I possibly damaging Het
Zfp641 T C 15: 98,290,583 I139V probably damaging Het
Zfyve21 A T 12: 111,823,281 I60F probably benign Het
Other mutations in Rbbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Rbbp8 APN 18 11722607 missense probably benign
IGL01302:Rbbp8 APN 18 11721979 missense probably benign
IGL01965:Rbbp8 APN 18 11722260 missense probably benign 0.04
IGL02076:Rbbp8 APN 18 11705819 missense probably damaging 1.00
IGL02410:Rbbp8 APN 18 11732212 missense probably damaging 1.00
IGL02823:Rbbp8 APN 18 11732213 missense possibly damaging 0.89
IGL02859:Rbbp8 APN 18 11738614 missense probably benign 0.42
IGL02966:Rbbp8 APN 18 11705812 missense possibly damaging 0.88
IGL03022:Rbbp8 APN 18 11725502 splice site probably benign
IGL03274:Rbbp8 APN 18 11741076 splice site probably benign
IGL03367:Rbbp8 APN 18 11721719 missense probably benign 0.08
R0063:Rbbp8 UTSW 18 11734557 splice site probably benign
R0063:Rbbp8 UTSW 18 11734557 splice site probably benign
R0167:Rbbp8 UTSW 18 11660922 nonsense probably null
R0314:Rbbp8 UTSW 18 11715818 missense probably benign 0.17
R0864:Rbbp8 UTSW 18 11732184 splice site probably benign
R1033:Rbbp8 UTSW 18 11742705 missense probably benign 0.41
R1678:Rbbp8 UTSW 18 11732315 missense probably benign 0.05
R1964:Rbbp8 UTSW 18 11742679 missense possibly damaging 0.62
R2002:Rbbp8 UTSW 18 11727166 splice site probably benign
R2015:Rbbp8 UTSW 18 11720624 missense probably benign 0.01
R2240:Rbbp8 UTSW 18 11677669 missense probably damaging 0.99
R2308:Rbbp8 UTSW 18 11696776 missense possibly damaging 0.95
R3946:Rbbp8 UTSW 18 11718868 missense probably benign
R4375:Rbbp8 UTSW 18 11725410 missense probably benign 0.00
R4590:Rbbp8 UTSW 18 11732265 nonsense probably null
R4695:Rbbp8 UTSW 18 11721782 nonsense probably null
R4769:Rbbp8 UTSW 18 11722670 missense probably damaging 1.00
R5161:Rbbp8 UTSW 18 11722114 missense probably damaging 1.00
R5195:Rbbp8 UTSW 18 11722151 missense probably benign 0.00
R5223:Rbbp8 UTSW 18 11721690 missense probably benign 0.19
R5573:Rbbp8 UTSW 18 11722607 missense probably benign
R5671:Rbbp8 UTSW 18 11742642 missense probably benign 0.00
R6051:Rbbp8 UTSW 18 11738607 missense probably benign 0.17
R6995:Rbbp8 UTSW 18 11718908 missense probably damaging 1.00
R7048:Rbbp8 UTSW 18 11732220 missense possibly damaging 0.92
R7261:Rbbp8 UTSW 18 11705742 missense probably damaging 0.99
R7305:Rbbp8 UTSW 18 11672581 critical splice acceptor site probably null
R7319:Rbbp8 UTSW 18 11732212 missense probably damaging 1.00
R7447:Rbbp8 UTSW 18 11660877 missense probably benign 0.00
R7949:Rbbp8 UTSW 18 11718835 missense probably benign 0.00
R8010:Rbbp8 UTSW 18 11722233 missense possibly damaging 0.67
R8116:Rbbp8 UTSW 18 11722670 missense probably damaging 1.00
R8292:Rbbp8 UTSW 18 11705712 missense probably benign
R8510:Rbbp8 UTSW 18 11696802 nonsense probably null
Z1176:Rbbp8 UTSW 18 11732262 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTGTATGCAGTCTTGAGAATTTCC -3'
(R):5'- CTGGGAGCTCTTAATGCTGC -3'

Sequencing Primer
(F):5'- CTAGTCACTTCAAAGTCTGCAATAC -3'
(R):5'- CTCTTAATGCTGCTTGATGATACAGG -3'
Posted On2020-07-28