Mutagenetix > Incidental Mutation

Incidental Mutation 'R8315:Lamc1'

641608

Institutional Source

Beutler Lab

Gene Symbol

Lamc1

Ensembl Gene

ENSMUSG00000026478

Gene Name

laminin, gamma 1

Synonyms

laminin B2, Lamb2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8315 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

153218922-153332786 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 153243421 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 817 (N817K)

Ref Sequence

ENSEMBL: ENSMUSP00000027752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027752]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027752
AA Change: N817K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: N817K

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
LamNT	42	282	1.97e-150	SMART
EGF_Lam	284	337	7.18e-7	SMART
EGF_Lam	340	393	7.93e-9	SMART
EGF_Lam	396	440	2.11e-13	SMART
EGF_Lam	443	490	2.87e-15	SMART
LamB	551	676	5.52e-48	SMART
Pfam:Laminin_EGF	683	718	1.3e-4	PFAM
EGF_Lam	722	768	2.38e-12	SMART
EGF_Lam	771	823	1.39e-4	SMART
EGF_Lam	826	879	8.05e-10	SMART
EGF_Lam	882	930	8.9e-12	SMART
EGF_Lam	933	978	1.26e-11	SMART
EGF_Lam	981	1026	7.4e-9	SMART
coiled coil region	1063	1594	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163011

SMART Domains

Protein: ENSMUSP00000124216
Gene: ENSMUSG00000026478

Domain	Start	End	E-Value	Type
coiled coil region	1	93	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	C	A	17: 33,067,064	A255S	probably benign	Het
4930402H24Rik	ATCCTCCTCCTCCTCCTCC	ATCCTCCTCCTCCTCC	2: 130,770,735		probably benign	Het
Abca13	A	T	11: 9,378,460	E3511V	probably null	Het
Abca13	A	G	11: 9,585,502	T4709A	probably benign	Het
Aff1	G	T	5: 103,811,090	V342F	probably damaging	Het
Ahnak2	T	A	12: 112,781,133	Q1698L		Het
Ajap1	G	T	4: 153,432,356	T176K	probably damaging	Het
Alkal2	G	T	12: 30,884,851	G23V	probably damaging	Het
Cct3	A	G	3: 88,313,257	T259A	probably benign	Het
Cdk8	C	T	5: 146,268,251	L21F	probably damaging	Het
Csf2rb	G	A	15: 78,347,381	G494D	possibly damaging	Het
Cstf3	G	T	2: 104,590,581		probably benign	Het
Cyp4f39	A	G	17: 32,482,202	D222G	probably benign	Het
Dcp2	T	C	18: 44,396,004	I62T	probably benign	Het
Dpp8	T	C	9: 65,080,851	*893Q	probably null	Het
Dpyd	A	T	3: 119,314,885	H859L	probably benign	Het
Dst	T	C	1: 34,284,420		probably null	Het
Egfr	A	G	11: 16,875,027	I456V	probably benign	Het
Elf3	A	G	1: 135,256,576	F185L	probably benign	Het
Emx1	A	G	6: 85,194,106	T164A	possibly damaging	Het
Fam212a	C	A	9: 107,984,307	S270I	probably damaging	Het
Fras1	G	A	5: 96,743,182	V2857M	probably damaging	Het
Gba2	AAAGAACCGTGTATACCGCCTGGGATGGAAAGAA	AAA	4: 43,569,937		probably null	Het
Gda	T	A	19: 21,417,071	T215S	probably benign	Het
Gm14443	C	T	2: 175,171,847		probably null	Het
Gm3448	A	G	17: 14,970,455	Y81H	probably damaging	Het
Gpr152	C	T	19: 4,143,470	P337S	probably damaging	Het
H2-T10	A	G	17: 36,119,013	I296T	probably benign	Het
Hoxd11	G	A	2: 74,683,122	E244K	probably benign	Het
Kazn	C	T	4: 142,141,691	D325N		Het
Lama2	T	C	10: 27,422,659	N147S	probably damaging	Het
Met	T	C	6: 17,533,957	S636P	probably damaging	Het
Mrgpra3	A	T	7: 47,601,303	M1K	probably null	Het
Myh15	C	A	16: 49,120,018	T777N	probably damaging	Het
Olfr1123	C	A	2: 87,418,651	A201D	probably damaging	Het
Olfr799	G	A	10: 129,647,653	C175Y	probably benign	Het
Olfr891	T	C	9: 38,180,209	T205A	probably benign	Het
Pbx2	A	G	17: 34,592,733	I60M	probably damaging	Het
Pla2g4a	T	C	1: 149,886,214	N164S	probably benign	Het
Poln	A	G	5: 34,109,373	M480T	probably benign	Het
Ppp2r2a	T	C	14: 67,023,728	N181S	probably damaging	Het
Ppp3r2	A	C	4: 49,681,705	F82V	probably damaging	Het
Prox2	A	G	12: 85,095,408	V7A	probably benign	Het
Ptpn3	A	T	4: 57,270,063	I33K	possibly damaging	Het
Rad21l	A	T	2: 151,655,240	M318K	probably benign	Het
Rftn1	A	G	17: 50,002,637	S445P	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,923		probably benign	Het
Rtp4	C	T	16: 23,613,248	P177S	possibly damaging	Het
Saa4	T	A	7: 46,729,628	N96I	possibly damaging	Het
Shb	A	G	4: 45,489,079	Y266H	probably damaging	Het
Slc45a4	T	G	15: 73,589,556	Y88S	probably damaging	Het
Tbccd1	A	G	16: 22,822,814	M312T	probably damaging	Het
Tecta	C	T	9: 42,387,825		probably null	Het
Tex33	T	C	15: 78,378,486	R262G	probably benign	Het
Tle1	A	T	4: 72,126,191	C526*	probably null	Het
Tmem87a	C	T	2: 120,403,960	G34D	probably damaging	Het
Trav13d-1	C	A	14: 52,851,602	Q23K	probably benign	Het
Txndc11	G	T	16: 11,075,601	T755N	possibly damaging	Het
Vmn1r223	A	G	13: 23,250,169	D311G	probably damaging	Het
Vmn2r66	T	A	7: 84,994,724	Y826F	possibly damaging	Het
Wdr90	A	T	17: 25,845,425	M1824K	probably benign	Het
Zfp523	G	A	17: 28,202,588	G440D	possibly damaging	Het

Other mutations in Lamc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Lamc1	APN	1	153240495	missense	probably damaging	1.00
IGL01397:Lamc1	APN	1	153251134	missense	probably damaging	1.00
IGL01661:Lamc1	APN	1	153221573	missense	possibly damaging	0.89
IGL01894:Lamc1	APN	1	153247082	missense	possibly damaging	0.51
IGL02000:Lamc1	APN	1	153240433	missense	probably damaging	1.00
IGL02649:Lamc1	APN	1	153247042	missense	possibly damaging	0.78
IGL02749:Lamc1	APN	1	153249853	missense	possibly damaging	0.51
IGL02819:Lamc1	APN	1	153250661	missense	probably damaging	1.00
IGL02831:Lamc1	APN	1	153247055	missense	probably benign	0.00
IGL03069:Lamc1	APN	1	153239381	missense	probably damaging	1.00
IGL03143:Lamc1	APN	1	153332274	missense	probably benign	0.00
IGL03166:Lamc1	APN	1	153332301	missense	probably benign	0.01
IGL03285:Lamc1	APN	1	153227685	missense	possibly damaging	0.96
IGL03294:Lamc1	APN	1	153262646	missense	probably damaging	1.00
pride	UTSW	1	153247284	missense	probably benign	0.01
Stratum	UTSW	1	153251124	nonsense	probably null
tier	UTSW	1	153250522	missense	probably damaging	1.00
PIT4280001:Lamc1	UTSW	1	153243471	missense	probably damaging	1.00
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0003:Lamc1	UTSW	1	153262439	missense	probably damaging	0.99
R0027:Lamc1	UTSW	1	153262583	missense	probably damaging	1.00
R0060:Lamc1	UTSW	1	153241868	unclassified	probably benign
R0078:Lamc1	UTSW	1	153229190	missense	probably damaging	0.96
R0157:Lamc1	UTSW	1	153262607	missense	probably benign	0.00
R0282:Lamc1	UTSW	1	153255312	missense	probably benign
R0374:Lamc1	UTSW	1	153251065	splice site	probably benign
R0494:Lamc1	UTSW	1	153246936	critical splice donor site	probably null
R0502:Lamc1	UTSW	1	153246932	splice site	probably benign
R0755:Lamc1	UTSW	1	153247450	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0791:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0791:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0792:Lamc1	UTSW	1	153234580	missense	possibly damaging	0.94
R0792:Lamc1	UTSW	1	153234595	missense	probably damaging	1.00
R0792:Lamc1	UTSW	1	153234612	missense	probably benign	0.01
R0892:Lamc1	UTSW	1	153332254	missense	possibly damaging	0.95
R0941:Lamc1	UTSW	1	153332274	missense	possibly damaging	0.72
R0961:Lamc1	UTSW	1	153221646	frame shift	probably null
R0961:Lamc1	UTSW	1	153221700	missense	probably benign	0.03
R0963:Lamc1	UTSW	1	153243386	missense	probably benign
R1127:Lamc1	UTSW	1	153250459	missense	possibly damaging	0.69
R1173:Lamc1	UTSW	1	153247231	splice site	probably benign
R1175:Lamc1	UTSW	1	153247231	splice site	probably benign
R1449:Lamc1	UTSW	1	153250495	missense	probably benign
R1481:Lamc1	UTSW	1	153221634	missense	probably damaging	1.00
R1565:Lamc1	UTSW	1	153242743	missense	probably benign	0.34
R1583:Lamc1	UTSW	1	153243478	critical splice acceptor site	probably null
R1643:Lamc1	UTSW	1	153258072	splice site	probably benign
R1652:Lamc1	UTSW	1	153249646	missense	probably damaging	1.00
R1691:Lamc1	UTSW	1	153247249	missense	probably benign	0.04
R1854:Lamc1	UTSW	1	153249872	missense	probably damaging	0.99
R2018:Lamc1	UTSW	1	153242632	missense	probably benign	0.07
R2170:Lamc1	UTSW	1	153249142	missense	probably benign	0.07
R2410:Lamc1	UTSW	1	153247395	missense	possibly damaging	0.61
R3438:Lamc1	UTSW	1	153226415	missense	probably benign	0.04
R3615:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3616:Lamc1	UTSW	1	153251150	missense	probably damaging	1.00
R3699:Lamc1	UTSW	1	153255205	missense	possibly damaging	0.79
R3811:Lamc1	UTSW	1	153262708	splice site	probably null
R4285:Lamc1	UTSW	1	153234552	missense	probably damaging	0.99
R4431:Lamc1	UTSW	1	153221528	missense	probably damaging	1.00
R4579:Lamc1	UTSW	1	153247269	missense	probably damaging	1.00
R4625:Lamc1	UTSW	1	153242696	missense	probably benign	0.04
R4649:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4650:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4651:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4652:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4653:Lamc1	UTSW	1	153228777	missense	probably damaging	0.99
R4784:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4785:Lamc1	UTSW	1	153231740	missense	probably damaging	1.00
R4853:Lamc1	UTSW	1	153229100	missense	possibly damaging	0.89
R5216:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5217:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5218:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5219:Lamc1	UTSW	1	153227696	missense	probably damaging	1.00
R5468:Lamc1	UTSW	1	153233564	missense	probably damaging	0.99
R5597:Lamc1	UTSW	1	153251970	missense	probably damaging	1.00
R5754:Lamc1	UTSW	1	153247284	missense	probably benign	0.01
R6233:Lamc1	UTSW	1	153223666	missense	probably benign
R6431:Lamc1	UTSW	1	153221671	missense	probably benign	0.21
R6636:Lamc1	UTSW	1	153241975	missense	possibly damaging	0.93
R6888:Lamc1	UTSW	1	153262492	missense	probably damaging	1.00
R7161:Lamc1	UTSW	1	153226454	missense	probably damaging	1.00
R7240:Lamc1	UTSW	1	153234650	missense	possibly damaging	0.82
R7388:Lamc1	UTSW	1	153249076	missense	probably damaging	1.00
R7474:Lamc1	UTSW	1	153332265	missense	possibly damaging	0.81
R7570:Lamc1	UTSW	1	153243275	missense	possibly damaging	0.64
R7583:Lamc1	UTSW	1	153243232	missense	possibly damaging	0.71
R7597:Lamc1	UTSW	1	153240454	missense	possibly damaging	0.94
R7635:Lamc1	UTSW	1	153249060	missense	probably damaging	1.00
R7976:Lamc1	UTSW	1	153247268	missense	probably damaging	1.00
R8012:Lamc1	UTSW	1	153221612	missense	probably benign	0.04
R8207:Lamc1	UTSW	1	153250522	missense	probably damaging	1.00
R8219:Lamc1	UTSW	1	153247327	missense	probably damaging	1.00
R8227:Lamc1	UTSW	1	153223754	missense	probably benign	0.04
R8417:Lamc1	UTSW	1	153230769	missense	probably damaging	1.00
R8685:Lamc1	UTSW	1	153233542	missense	probably benign	0.31
R8827:Lamc1	UTSW	1	153221678	missense	probably damaging	1.00
R8995:Lamc1	UTSW	1	153332247	missense	probably benign	0.00
R9061:Lamc1	UTSW	1	153251124	nonsense	probably null
R9141:Lamc1	UTSW	1	153247450	missense	probably benign	0.01
R9187:Lamc1	UTSW	1	153221688	nonsense	probably null
R9206:Lamc1	UTSW	1	153250451	missense	probably damaging	1.00
R9222:Lamc1	UTSW	1	153243341	missense	probably damaging	0.96
R9297:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9318:Lamc1	UTSW	1	153252000	missense	probably damaging	1.00
R9377:Lamc1	UTSW	1	153239263	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATTGGGAGCCAGGGGATTTC -3'
(R):5'- AAGTATGTCAAGGCCACTCC -3'

Sequencing Primer
(F):5'- GGATTTCCGAAAAACCCTTCCTTG -3'
(R):5'- AAGGCCACTCCACTGTTTTGG -3'

Posted On

2020-07-28