Incidental Mutation 'R8315:Dpyd'
ID 641617
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119314885 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 859 (H859L)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect probably benign
Transcript: ENSMUST00000039177
AA Change: H859L

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: H859L

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930402H24Rik ATCCTCCTCCTCCTCCTCC ATCCTCCTCCTCCTCC 2: 130,770,735 probably benign Het
Abca13 A T 11: 9,378,460 E3511V probably null Het
Abca13 A G 11: 9,585,502 T4709A probably benign Het
Aff1 G T 5: 103,811,090 V342F probably damaging Het
Ahnak2 T A 12: 112,781,133 Q1698L Het
Ajap1 G T 4: 153,432,356 T176K probably damaging Het
Cct3 A G 3: 88,313,257 T259A probably benign Het
Cdk8 C T 5: 146,268,251 L21F probably damaging Het
Csf2rb G A 15: 78,347,381 G494D possibly damaging Het
Cstf3 G T 2: 104,590,581 probably benign Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
Dcp2 T C 18: 44,396,004 I62T probably benign Het
Dpp8 T C 9: 65,080,851 *893Q probably null Het
Dst T C 1: 34,284,420 probably null Het
Egfr A G 11: 16,875,027 I456V probably benign Het
Elf3 A G 1: 135,256,576 F185L probably benign Het
Emx1 A G 6: 85,194,106 T164A possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam212a C A 9: 107,984,307 S270I probably damaging Het
Fras1 G A 5: 96,743,182 V2857M probably damaging Het
Gba2 AAAGAACCGTGTATACCGCCTGGGATGGAAAGAA AAA 4: 43,569,937 probably null Het
Gda T A 19: 21,417,071 T215S probably benign Het
Gm14443 C T 2: 175,171,847 probably null Het
Gm3448 A G 17: 14,970,455 Y81H probably damaging Het
Gpr152 C T 19: 4,143,470 P337S probably damaging Het
H2-T10 A G 17: 36,119,013 I296T probably benign Het
Hoxd11 G A 2: 74,683,122 E244K probably benign Het
Kazn C T 4: 142,141,691 D325N Het
Lama2 T C 10: 27,422,659 N147S probably damaging Het
Lamc1 A T 1: 153,243,421 N817K probably benign Het
Met T C 6: 17,533,957 S636P probably damaging Het
Mrgpra3 A T 7: 47,601,303 M1K probably null Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Olfr1123 C A 2: 87,418,651 A201D probably damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Olfr891 T C 9: 38,180,209 T205A probably benign Het
Pbx2 A G 17: 34,592,733 I60M probably damaging Het
Pla2g4a T C 1: 149,886,214 N164S probably benign Het
Poln A G 5: 34,109,373 M480T probably benign Het
Ppp2r2a T C 14: 67,023,728 N181S probably damaging Het
Ppp3r2 A C 4: 49,681,705 F82V probably damaging Het
Prox2 A G 12: 85,095,408 V7A probably benign Het
Ptpn3 A T 4: 57,270,063 I33K possibly damaging Het
Rad21l A T 2: 151,655,240 M318K probably benign Het
Rftn1 A G 17: 50,002,637 S445P possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Rtp4 C T 16: 23,613,248 P177S possibly damaging Het
Saa4 T A 7: 46,729,628 N96I possibly damaging Het
Shb A G 4: 45,489,079 Y266H probably damaging Het
Slc45a4 T G 15: 73,589,556 Y88S probably damaging Het
Tbccd1 A G 16: 22,822,814 M312T probably damaging Het
Tecta C T 9: 42,387,825 probably null Het
Tex33 T C 15: 78,378,486 R262G probably benign Het
Tle1 A T 4: 72,126,191 C526* probably null Het
Tmem87a C T 2: 120,403,960 G34D probably damaging Het
Trav13d-1 C A 14: 52,851,602 Q23K probably benign Het
Txndc11 G T 16: 11,075,601 T755N possibly damaging Het
Vmn1r223 A G 13: 23,250,169 D311G probably damaging Het
Vmn2r66 T A 7: 84,994,724 Y826F possibly damaging Het
Wdr90 A T 17: 25,845,425 M1824K probably benign Het
Zfp523 G A 17: 28,202,588 G440D possibly damaging Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
R8973:Dpyd UTSW 3 119314933 critical splice donor site probably null
R9070:Dpyd UTSW 3 118999243 missense probably damaging 0.98
R9132:Dpyd UTSW 3 118917248 missense probably damaging 1.00
R9198:Dpyd UTSW 3 118759654 critical splice acceptor site probably null
R9260:Dpyd UTSW 3 119314798 missense possibly damaging 0.95
R9307:Dpyd UTSW 3 119314911 missense probably benign
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTATCTGAAGAGATTGCTTTTGGTC -3'
(R):5'- ACATAGCTGTAATCAAGCCTGC -3'

Sequencing Primer
(F):5'- AAGAGATTGCTTTTGGTCTGATGTTC -3'
(R):5'- GCCTGCTTCAGAAAGATTCTACTGG -3'
Posted On 2020-07-28