Incidental Mutation 'R8315:Met'
ID641629
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Namemet proto-oncogene
SynonymsPar4, HGF receptor, c-Met
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8315 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location17463800-17573980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17533957 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 636 (S636P)
Ref Sequence ENSEMBL: ENSMUSP00000079324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443]
Predicted Effect probably damaging
Transcript: ENSMUST00000080469
AA Change: S636P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: S636P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115442
AA Change: S636P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: S636P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115443
AA Change: S636P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: S636P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152802
SMART Domains Protein: ENSMUSP00000118755
Gene: ENSMUSG00000009376

DomainStartEndE-ValueType
IPT 21 116 3.38e-16 SMART
IPT 118 202 4.34e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930402H24Rik ATCCTCCTCCTCCTCCTCC ATCCTCCTCCTCCTCC 2: 130,770,735 probably benign Het
Abca13 A T 11: 9,378,460 E3511V probably null Het
Abca13 A G 11: 9,585,502 T4709A probably benign Het
Aff1 G T 5: 103,811,090 V342F probably damaging Het
Ahnak2 T A 12: 112,781,133 Q1698L Het
Ajap1 G T 4: 153,432,356 T176K probably damaging Het
Cct3 A G 3: 88,313,257 T259A probably benign Het
Cdk8 C T 5: 146,268,251 L21F probably damaging Het
Csf2rb G A 15: 78,347,381 G494D possibly damaging Het
Cstf3 G T 2: 104,590,581 probably benign Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
Dcp2 T C 18: 44,396,004 I62T probably benign Het
Dpp8 T C 9: 65,080,851 *893Q probably null Het
Dpyd A T 3: 119,314,885 H859L probably benign Het
Dst T C 1: 34,284,420 probably null Het
Egfr A G 11: 16,875,027 I456V probably benign Het
Elf3 A G 1: 135,256,576 F185L probably benign Het
Emx1 A G 6: 85,194,106 T164A possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam212a C A 9: 107,984,307 S270I probably damaging Het
Fras1 G A 5: 96,743,182 V2857M probably damaging Het
Gba2 AAAGAACCGTGTATACCGCCTGGGATGGAAAGAA AAA 4: 43,569,937 probably null Het
Gda T A 19: 21,417,071 T215S probably benign Het
Gm14443 C T 2: 175,171,847 probably null Het
Gm3448 A G 17: 14,970,455 Y81H probably damaging Het
Gpr152 C T 19: 4,143,470 P337S probably damaging Het
H2-T10 A G 17: 36,119,013 I296T probably benign Het
Hoxd11 G A 2: 74,683,122 E244K probably benign Het
Kazn C T 4: 142,141,691 D325N Het
Lama2 T C 10: 27,422,659 N147S probably damaging Het
Lamc1 A T 1: 153,243,421 N817K probably benign Het
Mrgpra3 A T 7: 47,601,303 M1K probably null Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Olfr1123 C A 2: 87,418,651 A201D probably damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Olfr891 T C 9: 38,180,209 T205A probably benign Het
Pbx2 A G 17: 34,592,733 I60M probably damaging Het
Pla2g4a T C 1: 149,886,214 N164S probably benign Het
Poln A G 5: 34,109,373 M480T probably benign Het
Ppp2r2a T C 14: 67,023,728 N181S probably damaging Het
Ppp3r2 A C 4: 49,681,705 F82V probably damaging Het
Prox2 A G 12: 85,095,408 V7A probably benign Het
Ptpn3 A T 4: 57,270,063 I33K possibly damaging Het
Rad21l A T 2: 151,655,240 M318K probably benign Het
Rftn1 A G 17: 50,002,637 S445P possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Rtp4 C T 16: 23,613,248 P177S possibly damaging Het
Saa4 T A 7: 46,729,628 N96I possibly damaging Het
Shb A G 4: 45,489,079 Y266H probably damaging Het
Slc45a4 T G 15: 73,589,556 Y88S probably damaging Het
Tbccd1 A G 16: 22,822,814 M312T probably damaging Het
Tecta C T 9: 42,387,825 probably null Het
Tex33 T C 15: 78,378,486 R262G probably benign Het
Tle1 A T 4: 72,126,191 C526* probably null Het
Tmem87a C T 2: 120,403,960 G34D probably damaging Het
Trav13d-1 C A 14: 52,851,602 Q23K probably benign Het
Txndc11 G T 16: 11,075,601 T755N possibly damaging Het
Vmn1r223 A G 13: 23,250,169 D311G probably damaging Het
Vmn2r66 T A 7: 84,994,724 Y826F possibly damaging Het
Wdr90 A T 17: 25,845,425 M1824K probably benign Het
Zfp523 G A 17: 28,202,588 G440D possibly damaging Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17534937 unclassified probably benign
IGL01066:Met APN 6 17535105 critical splice donor site probably null
IGL01344:Met APN 6 17547032 missense probably benign 0.44
IGL01413:Met APN 6 17558896 splice site probably benign
IGL01608:Met APN 6 17558730 missense probably damaging 1.00
IGL01613:Met APN 6 17540577 missense probably damaging 1.00
IGL01820:Met APN 6 17534231 missense possibly damaging 0.89
IGL01843:Met APN 6 17491701 missense probably damaging 1.00
IGL02014:Met APN 6 17527257 splice site probably benign
IGL02027:Met APN 6 17563727 splice site probably benign
IGL02243:Met APN 6 17549094 missense probably damaging 1.00
IGL02373:Met APN 6 17491529 missense probably damaging 1.00
IGL02616:Met APN 6 17553347 missense probably damaging 1.00
IGL02702:Met APN 6 17534143 missense possibly damaging 0.92
IGL02704:Met APN 6 17491257 missense possibly damaging 0.62
IGL02714:Met APN 6 17491852 nonsense probably null
IGL02936:Met APN 6 17553397 missense probably damaging 1.00
IGL02943:Met APN 6 17535929 missense possibly damaging 0.84
IGL03057:Met APN 6 17558766 missense probably damaging 1.00
IGL03124:Met APN 6 17492078 missense probably benign 0.27
IGL03171:Met APN 6 17562273 splice site probably benign
IGL03266:Met APN 6 17540538 missense possibly damaging 0.61
IGL03285:Met APN 6 17553337 missense probably damaging 0.98
R0453:Met UTSW 6 17534198 missense possibly damaging 0.88
R0543:Met UTSW 6 17491970 missense probably damaging 1.00
R0601:Met UTSW 6 17555632 splice site probably null
R0652:Met UTSW 6 17491710 missense probably benign 0.00
R0941:Met UTSW 6 17491394 missense probably damaging 1.00
R1142:Met UTSW 6 17527183 nonsense probably null
R1553:Met UTSW 6 17491461 missense probably benign 0.01
R1569:Met UTSW 6 17531504 nonsense probably null
R1744:Met UTSW 6 17540646 missense possibly damaging 0.47
R2224:Met UTSW 6 17563722 splice site probably null
R2308:Met UTSW 6 17491742 missense probably benign 0.00
R2369:Met UTSW 6 17531528 missense probably benign 0.04
R2393:Met UTSW 6 17534198 missense probably damaging 0.99
R2419:Met UTSW 6 17535830 splice site probably benign
R2483:Met UTSW 6 17549086 missense probably damaging 1.00
R2511:Met UTSW 6 17491967 missense probably damaging 1.00
R3622:Met UTSW 6 17549086 missense probably damaging 1.00
R3623:Met UTSW 6 17549086 missense probably damaging 1.00
R3624:Met UTSW 6 17549086 missense probably damaging 1.00
R4050:Met UTSW 6 17533984 missense probably benign
R4051:Met UTSW 6 17548729 missense possibly damaging 0.86
R4159:Met UTSW 6 17562272 splice site probably null
R4208:Met UTSW 6 17548729 missense possibly damaging 0.86
R4622:Met UTSW 6 17513384 missense probably benign 0.19
R4672:Met UTSW 6 17571804 missense probably benign 0.33
R4737:Met UTSW 6 17491541 missense probably damaging 1.00
R4738:Met UTSW 6 17491541 missense probably damaging 1.00
R4834:Met UTSW 6 17491413 missense probably damaging 0.97
R4846:Met UTSW 6 17491929 missense probably damaging 0.99
R4855:Met UTSW 6 17558797 missense probably damaging 1.00
R4878:Met UTSW 6 17549059 missense probably damaging 1.00
R4902:Met UTSW 6 17546996 missense probably damaging 1.00
R5208:Met UTSW 6 17526423 nonsense probably null
R5355:Met UTSW 6 17491362 missense probably damaging 1.00
R5415:Met UTSW 6 17527085 missense probably benign 0.01
R5556:Met UTSW 6 17534176 missense probably benign 0.04
R5590:Met UTSW 6 17548782 missense probably benign 0.00
R5683:Met UTSW 6 17571744 missense probably damaging 1.00
R5872:Met UTSW 6 17562198 missense probably damaging 1.00
R5891:Met UTSW 6 17491539 missense probably benign 0.02
R5895:Met UTSW 6 17531582 missense probably benign 0.02
R6063:Met UTSW 6 17491968 missense probably damaging 1.00
R6262:Met UTSW 6 17553404 missense probably benign 0.00
R6362:Met UTSW 6 17558733 missense probably damaging 1.00
R6747:Met UTSW 6 17571467 missense probably damaging 1.00
R6966:Met UTSW 6 17531532 missense possibly damaging 0.65
R6989:Met UTSW 6 17535928 missense possibly damaging 0.67
R6989:Met UTSW 6 17535929 missense probably damaging 1.00
R7017:Met UTSW 6 17491287 nonsense probably null
R7037:Met UTSW 6 17547128 intron probably benign
R7141:Met UTSW 6 17527155 missense probably benign 0.01
R7242:Met UTSW 6 17491317 missense probably damaging 1.00
R7282:Met UTSW 6 17547012 nonsense probably null
R7624:Met UTSW 6 17558835 missense probably damaging 1.00
R7770:Met UTSW 6 17491407 missense possibly damaging 0.79
R7797:Met UTSW 6 17533953 missense probably damaging 1.00
R8082:Met UTSW 6 17492313 missense probably damaging 0.98
R8109:Met UTSW 6 17562237 missense probably damaging 1.00
R8162:Met UTSW 6 17547062 missense probably damaging 0.98
R8325:Met UTSW 6 17571672 missense probably damaging 1.00
R8348:Met UTSW 6 17571800 missense probably benign 0.00
R8354:Met UTSW 6 17491769 missense probably damaging 1.00
R8448:Met UTSW 6 17571800 missense probably benign 0.00
R8454:Met UTSW 6 17491769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCTATTTGGAGTCATGAGC -3'
(R):5'- AGTGAGTAAGGTGCCTCCAG -3'

Sequencing Primer
(F):5'- AGTCATGAGCTCACAATTTGGG -3'
(R):5'- CGTACCTCGGAGAAATGCTTG -3'
Posted On2020-07-28