Incidental Mutation 'R8315:Egfr'
ID641643
Institutional Source Beutler Lab
Gene Symbol Egfr
Ensembl Gene ENSMUSG00000020122
Gene Nameepidermal growth factor receptor
Synonymsavian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R8315 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location16752203-16918158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16875027 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 456 (I456V)
Ref Sequence ENSEMBL: ENSMUSP00000020329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884] [ENSMUST00000125984]
Predicted Effect probably benign
Transcript: ENSMUST00000020329
AA Change: I456V

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: I456V

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 1.4e-32 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 1.8e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.05e1 SMART
low complexity region 677 694 N/A INTRINSIC
TyrKc 714 970 2.88e-129 SMART
low complexity region 1004 1017 N/A INTRINSIC
low complexity region 1027 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102884
AA Change: I456V

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122
AA Change: I456V

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:Recep_L_domain 57 168 5e-33 PFAM
low complexity region 182 195 N/A INTRINSIC
FU 228 270 6.07e-4 SMART
Pfam:Recep_L_domain 361 481 2e-29 PFAM
FU 496 547 8.25e-6 SMART
FU 552 601 4.38e-10 SMART
FU 614 654 4.54e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125984
SMART Domains Protein: ENSMUSP00000122632
Gene: ENSMUSG00000020122

DomainStartEndE-ValueType
FU 1 40 2.55e0 SMART
FU 45 94 4.38e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930402H24Rik ATCCTCCTCCTCCTCCTCC ATCCTCCTCCTCCTCC 2: 130,770,735 probably benign Het
Abca13 A T 11: 9,378,460 E3511V probably null Het
Abca13 A G 11: 9,585,502 T4709A probably benign Het
Aff1 G T 5: 103,811,090 V342F probably damaging Het
Ahnak2 T A 12: 112,781,133 Q1698L Het
Ajap1 G T 4: 153,432,356 T176K probably damaging Het
Cct3 A G 3: 88,313,257 T259A probably benign Het
Cdk8 C T 5: 146,268,251 L21F probably damaging Het
Csf2rb G A 15: 78,347,381 G494D possibly damaging Het
Cstf3 G T 2: 104,590,581 probably benign Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
Dcp2 T C 18: 44,396,004 I62T probably benign Het
Dpp8 T C 9: 65,080,851 *893Q probably null Het
Dpyd A T 3: 119,314,885 H859L probably benign Het
Dst T C 1: 34,284,420 probably null Het
Elf3 A G 1: 135,256,576 F185L probably benign Het
Emx1 A G 6: 85,194,106 T164A possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam212a C A 9: 107,984,307 S270I probably damaging Het
Fras1 G A 5: 96,743,182 V2857M probably damaging Het
Gba2 AAAGAACCGTGTATACCGCCTGGGATGGAAAGAA AAA 4: 43,569,937 probably null Het
Gda T A 19: 21,417,071 T215S probably benign Het
Gm14443 C T 2: 175,171,847 probably null Het
Gm3448 A G 17: 14,970,455 Y81H probably damaging Het
Gpr152 C T 19: 4,143,470 P337S probably damaging Het
H2-T10 A G 17: 36,119,013 I296T probably benign Het
Hoxd11 G A 2: 74,683,122 E244K probably benign Het
Kazn C T 4: 142,141,691 D325N Het
Lama2 T C 10: 27,422,659 N147S probably damaging Het
Lamc1 A T 1: 153,243,421 N817K probably benign Het
Met T C 6: 17,533,957 S636P probably damaging Het
Mrgpra3 A T 7: 47,601,303 M1K probably null Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Olfr1123 C A 2: 87,418,651 A201D probably damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Olfr891 T C 9: 38,180,209 T205A probably benign Het
Pbx2 A G 17: 34,592,733 I60M probably damaging Het
Pla2g4a T C 1: 149,886,214 N164S probably benign Het
Poln A G 5: 34,109,373 M480T probably benign Het
Ppp2r2a T C 14: 67,023,728 N181S probably damaging Het
Ppp3r2 A C 4: 49,681,705 F82V probably damaging Het
Prox2 A G 12: 85,095,408 V7A probably benign Het
Ptpn3 A T 4: 57,270,063 I33K possibly damaging Het
Rad21l A T 2: 151,655,240 M318K probably benign Het
Rftn1 A G 17: 50,002,637 S445P possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Rtp4 C T 16: 23,613,248 P177S possibly damaging Het
Saa4 T A 7: 46,729,628 N96I possibly damaging Het
Shb A G 4: 45,489,079 Y266H probably damaging Het
Slc45a4 T G 15: 73,589,556 Y88S probably damaging Het
Tbccd1 A G 16: 22,822,814 M312T probably damaging Het
Tecta C T 9: 42,387,825 probably null Het
Tex33 T C 15: 78,378,486 R262G probably benign Het
Tle1 A T 4: 72,126,191 C526* probably null Het
Tmem87a C T 2: 120,403,960 G34D probably damaging Het
Trav13d-1 C A 14: 52,851,602 Q23K probably benign Het
Txndc11 G T 16: 11,075,601 T755N possibly damaging Het
Vmn1r223 A G 13: 23,250,169 D311G probably damaging Het
Vmn2r66 T A 7: 84,994,724 Y826F possibly damaging Het
Wdr90 A T 17: 25,845,425 M1824K probably benign Het
Zfp523 G A 17: 28,202,588 G440D possibly damaging Het
Other mutations in Egfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Egfr APN 11 16863020 missense probably damaging 1.00
IGL01529:Egfr APN 11 16863014 missense probably benign
IGL01556:Egfr APN 11 16905382 missense probably damaging 1.00
IGL02627:Egfr APN 11 16869346 missense probably damaging 1.00
IGL02862:Egfr APN 11 16883562 missense probably benign 0.25
IGL02945:Egfr APN 11 16752514 missense probably damaging 1.00
IGL02994:Egfr APN 11 16911811 missense probably damaging 1.00
IGL03395:Egfr APN 11 16910261 splice site probably benign
set UTSW 11 16871881 splice site probably benign
Velvet UTSW 11 16904399 missense probably damaging 1.00
PIT1430001:Egfr UTSW 11 16910214 missense probably benign 0.00
R0196:Egfr UTSW 11 16911746 missense probably benign 0.02
R0513:Egfr UTSW 11 16872855 missense probably damaging 1.00
R0567:Egfr UTSW 11 16872873 missense probably benign 0.01
R0629:Egfr UTSW 11 16869333 missense probably damaging 1.00
R0961:Egfr UTSW 11 16862964 missense probably damaging 1.00
R1163:Egfr UTSW 11 16883546 missense probably benign 0.02
R1454:Egfr UTSW 11 16889920 missense probably benign
R1456:Egfr UTSW 11 16863065 missense probably benign 0.00
R1503:Egfr UTSW 11 16869301 missense possibly damaging 0.86
R1577:Egfr UTSW 11 16869241 missense probably benign 0.04
R1595:Egfr UTSW 11 16906847 missense probably damaging 0.99
R1699:Egfr UTSW 11 16859019 missense probably benign 0.14
R2172:Egfr UTSW 11 16911562 missense probably benign 0.00
R3690:Egfr UTSW 11 16871881 splice site probably benign
R3922:Egfr UTSW 11 16881495 missense probably damaging 1.00
R4444:Egfr UTSW 11 16871027 missense probably benign 0.00
R4685:Egfr UTSW 11 16858980 missense probably damaging 1.00
R4737:Egfr UTSW 11 16869231 missense probably damaging 0.99
R4814:Egfr UTSW 11 16869354 missense probably damaging 1.00
R4841:Egfr UTSW 11 16911607 missense probably benign 0.05
R4842:Egfr UTSW 11 16911607 missense probably benign 0.05
R4903:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4964:Egfr UTSW 11 16908949 missense probably damaging 1.00
R4985:Egfr UTSW 11 16859029 nonsense probably null
R4998:Egfr UTSW 11 16881493 missense possibly damaging 0.58
R5001:Egfr UTSW 11 16904434 missense probably damaging 0.98
R5304:Egfr UTSW 11 16884260 missense probably benign
R5309:Egfr UTSW 11 16911703 missense probably benign 0.00
R5653:Egfr UTSW 11 16911617 missense probably benign 0.04
R5905:Egfr UTSW 11 16911494 missense probably damaging 1.00
R6051:Egfr UTSW 11 16883607 missense possibly damaging 0.87
R6052:Egfr UTSW 11 16911554 missense probably benign 0.16
R6114:Egfr UTSW 11 16904374 missense possibly damaging 0.46
R6261:Egfr UTSW 11 16889964 missense probably benign 0.11
R6434:Egfr UTSW 11 16869294 missense probably benign 0.25
R6475:Egfr UTSW 11 16891259 missense probably benign
R6799:Egfr UTSW 11 16896952 missense probably damaging 1.00
R7143:Egfr UTSW 11 16871627 missense probably benign 0.20
R7195:Egfr UTSW 11 16868162 missense probably damaging 1.00
R7459:Egfr UTSW 11 16896967 missense probably damaging 1.00
R7612:Egfr UTSW 11 16859025 missense possibly damaging 0.74
R7757:Egfr UTSW 11 16889966 missense possibly damaging 0.64
R7763:Egfr UTSW 11 16891266 missense probably damaging 1.00
R8320:Egfr UTSW 11 16891251 missense probably damaging 1.00
R8324:Egfr UTSW 11 16858971 missense probably damaging 0.99
R8324:Egfr UTSW 11 16908885 missense probably damaging 0.98
R8347:Egfr UTSW 11 16878174 missense probably damaging 1.00
R8440:Egfr UTSW 11 16909831 missense probably damaging 1.00
R8511:Egfr UTSW 11 16896949 missense probably damaging 1.00
Z1177:Egfr UTSW 11 16862954 missense probably benign 0.05
Z1177:Egfr UTSW 11 16869319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTGTGATTCATACTTTTCGCAG -3'
(R):5'- ACTAAGTTACCTCCGGGAACTATC -3'

Sequencing Primer
(F):5'- TCGCAGAATGATTAGTAATAACTGG -3'
(R):5'- TCCGGGAACTATCTGTGCAG -3'
Posted On2020-07-28