Incidental Mutation 'R8315:Csf2rb'
ID 641651
Institutional Source Beutler Lab
Gene Symbol Csf2rb
Ensembl Gene ENSMUSG00000071713
Gene Name colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Synonyms Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131
MMRRC Submission
Accession Numbers

Genbank: NM_007780; MGI: 1339759

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8315 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 78325752-78353847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78347381 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 494 (G494D)
Ref Sequence ENSEMBL: ENSMUSP00000094082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096355]
AlphaFold P26955
Predicted Effect possibly damaging
Transcript: ENSMUST00000096355
AA Change: G494D

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713
AA Change: G494D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1gh7a1 29 130 6e-58 SMART
FN3 136 224 4.44e0 SMART
Blast:FN3 245 338 3e-24 BLAST
SCOP:d1gh7a3 245 338 2e-45 SMART
FN3 343 426 2.41e0 SMART
transmembrane domain 446 468 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930402H24Rik ATCCTCCTCCTCCTCCTCC ATCCTCCTCCTCCTCC 2: 130,770,735 probably benign Het
Abca13 A T 11: 9,378,460 E3511V probably null Het
Abca13 A G 11: 9,585,502 T4709A probably benign Het
Aff1 G T 5: 103,811,090 V342F probably damaging Het
Ahnak2 T A 12: 112,781,133 Q1698L Het
Ajap1 G T 4: 153,432,356 T176K probably damaging Het
Cct3 A G 3: 88,313,257 T259A probably benign Het
Cdk8 C T 5: 146,268,251 L21F probably damaging Het
Cstf3 G T 2: 104,590,581 probably benign Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
Dcp2 T C 18: 44,396,004 I62T probably benign Het
Dpp8 T C 9: 65,080,851 *893Q probably null Het
Dpyd A T 3: 119,314,885 H859L probably benign Het
Dst T C 1: 34,284,420 probably null Het
Egfr A G 11: 16,875,027 I456V probably benign Het
Elf3 A G 1: 135,256,576 F185L probably benign Het
Emx1 A G 6: 85,194,106 T164A possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam212a C A 9: 107,984,307 S270I probably damaging Het
Fras1 G A 5: 96,743,182 V2857M probably damaging Het
Gba2 AAAGAACCGTGTATACCGCCTGGGATGGAAAGAA AAA 4: 43,569,937 probably null Het
Gda T A 19: 21,417,071 T215S probably benign Het
Gm14443 C T 2: 175,171,847 probably null Het
Gm3448 A G 17: 14,970,455 Y81H probably damaging Het
Gpr152 C T 19: 4,143,470 P337S probably damaging Het
H2-T10 A G 17: 36,119,013 I296T probably benign Het
Hoxd11 G A 2: 74,683,122 E244K probably benign Het
Kazn C T 4: 142,141,691 D325N Het
Lama2 T C 10: 27,422,659 N147S probably damaging Het
Lamc1 A T 1: 153,243,421 N817K probably benign Het
Met T C 6: 17,533,957 S636P probably damaging Het
Mrgpra3 A T 7: 47,601,303 M1K probably null Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Olfr1123 C A 2: 87,418,651 A201D probably damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Olfr891 T C 9: 38,180,209 T205A probably benign Het
Pbx2 A G 17: 34,592,733 I60M probably damaging Het
Pla2g4a T C 1: 149,886,214 N164S probably benign Het
Poln A G 5: 34,109,373 M480T probably benign Het
Ppp2r2a T C 14: 67,023,728 N181S probably damaging Het
Ppp3r2 A C 4: 49,681,705 F82V probably damaging Het
Prox2 A G 12: 85,095,408 V7A probably benign Het
Ptpn3 A T 4: 57,270,063 I33K possibly damaging Het
Rad21l A T 2: 151,655,240 M318K probably benign Het
Rftn1 A G 17: 50,002,637 S445P possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Rtp4 C T 16: 23,613,248 P177S possibly damaging Het
Saa4 T A 7: 46,729,628 N96I possibly damaging Het
Shb A G 4: 45,489,079 Y266H probably damaging Het
Slc45a4 T G 15: 73,589,556 Y88S probably damaging Het
Tbccd1 A G 16: 22,822,814 M312T probably damaging Het
Tecta C T 9: 42,387,825 probably null Het
Tex33 T C 15: 78,378,486 R262G probably benign Het
Tle1 A T 4: 72,126,191 C526* probably null Het
Tmem87a C T 2: 120,403,960 G34D probably damaging Het
Trav13d-1 C A 14: 52,851,602 Q23K probably benign Het
Txndc11 G T 16: 11,075,601 T755N possibly damaging Het
Vmn1r223 A G 13: 23,250,169 D311G probably damaging Het
Vmn2r66 T A 7: 84,994,724 Y826F possibly damaging Het
Wdr90 A T 17: 25,845,425 M1824K probably benign Het
Zfp523 G A 17: 28,202,588 G440D possibly damaging Het
Other mutations in Csf2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Csf2rb APN 15 78348514 nonsense probably null
IGL00979:Csf2rb APN 15 78348104 missense probably damaging 1.00
IGL01613:Csf2rb APN 15 78335302 intron probably benign
IGL01724:Csf2rb APN 15 78336414 missense probably damaging 1.00
IGL01942:Csf2rb APN 15 78340492 missense probably benign
IGL02479:Csf2rb APN 15 78341724 nonsense probably null
3-1:Csf2rb UTSW 15 78344603 missense probably damaging 1.00
IGL02802:Csf2rb UTSW 15 78338903 missense probably benign 0.00
R0133:Csf2rb UTSW 15 78339004 unclassified probably benign
R0179:Csf2rb UTSW 15 78336372 missense possibly damaging 0.52
R0487:Csf2rb UTSW 15 78348331 missense probably benign 0.00
R1544:Csf2rb UTSW 15 78340755 missense probably benign 0.02
R1619:Csf2rb UTSW 15 78335211 missense probably damaging 0.99
R1690:Csf2rb UTSW 15 78348644 missense probably benign 0.11
R1831:Csf2rb UTSW 15 78348253 missense probably benign 0.03
R3970:Csf2rb UTSW 15 78341467 missense probably benign
R4922:Csf2rb UTSW 15 78346467 missense probably benign 0.02
R5151:Csf2rb UTSW 15 78340581 missense probably damaging 1.00
R5202:Csf2rb UTSW 15 78349057 missense possibly damaging 0.51
R5398:Csf2rb UTSW 15 78348620 missense probably benign
R5496:Csf2rb UTSW 15 78340561 missense probably damaging 1.00
R5786:Csf2rb UTSW 15 78348955 missense probably damaging 1.00
R6166:Csf2rb UTSW 15 78344566 missense probably damaging 1.00
R6347:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6350:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6899:Csf2rb UTSW 15 78340702 missense probably benign 0.01
R6984:Csf2rb UTSW 15 78345519 missense probably damaging 1.00
R7484:Csf2rb UTSW 15 78338899 missense possibly damaging 0.53
R7671:Csf2rb UTSW 15 78338930 missense probably damaging 1.00
R7751:Csf2rb UTSW 15 78341639 missense probably damaging 1.00
R7781:Csf2rb UTSW 15 78344571 missense probably benign 0.00
R7861:Csf2rb UTSW 15 78349157 missense probably damaging 1.00
R8135:Csf2rb UTSW 15 78348119 missense possibly damaging 0.95
R8154:Csf2rb UTSW 15 78340442 critical splice acceptor site probably null
R8299:Csf2rb UTSW 15 78346469 missense possibly damaging 0.88
R8926:Csf2rb UTSW 15 78340549 missense probably benign
R8948:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R8950:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R9265:Csf2rb UTSW 15 78348546 missense probably benign 0.08
X0024:Csf2rb UTSW 15 78336360 missense probably damaging 1.00
X0028:Csf2rb UTSW 15 78349002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATAGGGAACAGCATGGC -3'
(R):5'- GAGACCCACAGGCTACAATG -3'

Sequencing Primer
(F):5'- CTTACCTCAGGAGCTTTAGGGCTAAG -3'
(R):5'- GCTACAATGATGTGCACCATG -3'
Posted On 2020-07-28