Incidental Mutation 'R8315:Dcp2'
ID641665
Institutional Source Beutler Lab
Gene Symbol Dcp2
Ensembl Gene ENSMUSG00000024472
Gene Namedecapping mRNA 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R8315 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location44380502-44424969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44396004 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 62 (I62T)
Ref Sequence ENSEMBL: ENSMUSP00000025350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025350] [ENSMUST00000202306]
Predicted Effect probably benign
Transcript: ENSMUST00000025350
AA Change: I62T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000025350
Gene: ENSMUSG00000024472
AA Change: I62T

DomainStartEndE-ValueType
DCP2 10 94 4.23e-50 SMART
Pfam:NUDIX 97 219 6.5e-17 PFAM
low complexity region 240 258 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202306
AA Change: I62T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144010
Gene: ENSMUSG00000024472
AA Change: I62T

DomainStartEndE-ValueType
DCP2 10 82 5.7e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of an mRNA-decapping complex required for degradation of mRNAs, both in normal mRNA turnover, and in nonsense-mediated mRNA decay (NMD). It removes the 7-methyl guanine cap structure from mRNA, prior to its degradation from the 5' end. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930402H24Rik ATCCTCCTCCTCCTCCTCC ATCCTCCTCCTCCTCC 2: 130,770,735 probably benign Het
Abca13 A T 11: 9,378,460 E3511V probably null Het
Abca13 A G 11: 9,585,502 T4709A probably benign Het
Aff1 G T 5: 103,811,090 V342F probably damaging Het
Ahnak2 T A 12: 112,781,133 Q1698L Het
Ajap1 G T 4: 153,432,356 T176K probably damaging Het
Cct3 A G 3: 88,313,257 T259A probably benign Het
Cdk8 C T 5: 146,268,251 L21F probably damaging Het
Csf2rb G A 15: 78,347,381 G494D possibly damaging Het
Cstf3 G T 2: 104,590,581 probably benign Het
Cyp4f39 A G 17: 32,482,202 D222G probably benign Het
Dpp8 T C 9: 65,080,851 *893Q probably null Het
Dpyd A T 3: 119,314,885 H859L probably benign Het
Dst T C 1: 34,284,420 probably null Het
Egfr A G 11: 16,875,027 I456V probably benign Het
Elf3 A G 1: 135,256,576 F185L probably benign Het
Emx1 A G 6: 85,194,106 T164A possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam212a C A 9: 107,984,307 S270I probably damaging Het
Fras1 G A 5: 96,743,182 V2857M probably damaging Het
Gba2 AAAGAACCGTGTATACCGCCTGGGATGGAAAGAA AAA 4: 43,569,937 probably null Het
Gda T A 19: 21,417,071 T215S probably benign Het
Gm14443 C T 2: 175,171,847 probably null Het
Gm3448 A G 17: 14,970,455 Y81H probably damaging Het
Gpr152 C T 19: 4,143,470 P337S probably damaging Het
H2-T10 A G 17: 36,119,013 I296T probably benign Het
Hoxd11 G A 2: 74,683,122 E244K probably benign Het
Kazn C T 4: 142,141,691 D325N Het
Lama2 T C 10: 27,422,659 N147S probably damaging Het
Lamc1 A T 1: 153,243,421 N817K probably benign Het
Met T C 6: 17,533,957 S636P probably damaging Het
Mrgpra3 A T 7: 47,601,303 M1K probably null Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Olfr1123 C A 2: 87,418,651 A201D probably damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Olfr891 T C 9: 38,180,209 T205A probably benign Het
Pbx2 A G 17: 34,592,733 I60M probably damaging Het
Pla2g4a T C 1: 149,886,214 N164S probably benign Het
Poln A G 5: 34,109,373 M480T probably benign Het
Ppp2r2a T C 14: 67,023,728 N181S probably damaging Het
Ppp3r2 A C 4: 49,681,705 F82V probably damaging Het
Prox2 A G 12: 85,095,408 V7A probably benign Het
Ptpn3 A T 4: 57,270,063 I33K possibly damaging Het
Rad21l A T 2: 151,655,240 M318K probably benign Het
Rftn1 A G 17: 50,002,637 S445P possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Rtp4 C T 16: 23,613,248 P177S possibly damaging Het
Saa4 T A 7: 46,729,628 N96I possibly damaging Het
Shb A G 4: 45,489,079 Y266H probably damaging Het
Slc45a4 T G 15: 73,589,556 Y88S probably damaging Het
Tbccd1 A G 16: 22,822,814 M312T probably damaging Het
Tecta C T 9: 42,387,825 probably null Het
Tex33 T C 15: 78,378,486 R262G probably benign Het
Tle1 A T 4: 72,126,191 C526* probably null Het
Tmem87a C T 2: 120,403,960 G34D probably damaging Het
Trav13d-1 C A 14: 52,851,602 Q23K probably benign Het
Txndc11 G T 16: 11,075,601 T755N possibly damaging Het
Vmn1r223 A G 13: 23,250,169 D311G probably damaging Het
Vmn2r66 T A 7: 84,994,724 Y826F possibly damaging Het
Wdr90 A T 17: 25,845,425 M1824K probably benign Het
Zfp523 G A 17: 28,202,588 G440D possibly damaging Het
Other mutations in Dcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02801:Dcp2 APN 18 44417711 missense probably damaging 1.00
belay UTSW 18 44395952 missense probably damaging 0.99
PIT4431001:Dcp2 UTSW 18 44412571 missense probably benign 0.15
R0051:Dcp2 UTSW 18 44405374 splice site probably benign
R0515:Dcp2 UTSW 18 44399731 missense probably benign 0.41
R0761:Dcp2 UTSW 18 44410233 missense probably benign 0.01
R1696:Dcp2 UTSW 18 44400324 missense probably damaging 1.00
R1803:Dcp2 UTSW 18 44395917 missense probably damaging 1.00
R1928:Dcp2 UTSW 18 44405571 critical splice donor site probably null
R1964:Dcp2 UTSW 18 44395971 missense possibly damaging 0.50
R2014:Dcp2 UTSW 18 44410296 missense probably benign 0.00
R2209:Dcp2 UTSW 18 44405514 nonsense probably null
R4167:Dcp2 UTSW 18 44395967 missense probably damaging 1.00
R4668:Dcp2 UTSW 18 44415362 splice site probably null
R4877:Dcp2 UTSW 18 44417592 missense probably benign 0.11
R5147:Dcp2 UTSW 18 44417595 nonsense probably null
R5559:Dcp2 UTSW 18 44405487 missense probably damaging 1.00
R6533:Dcp2 UTSW 18 44399664 missense probably benign 0.25
R7406:Dcp2 UTSW 18 44410187 missense probably benign 0.00
R7469:Dcp2 UTSW 18 44395952 missense probably damaging 0.99
R7850:Dcp2 UTSW 18 44400348 nonsense probably null
R8054:Dcp2 UTSW 18 44405707 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCTCGCCTTTCCTAGTTGG -3'
(R):5'- CACTTCAGTGCCGCGAAAA -3'

Sequencing Primer
(F):5'- CCTTTCCTAGTTGGTGGGTG -3'
(R):5'- CTTCAGTGCCGCGAAAAAGGAG -3'
Posted On2020-07-28