Incidental Mutation 'R8316:Zmat3'
ID641676
Institutional Source Beutler Lab
Gene Symbol Zmat3
Ensembl Gene ENSMUSG00000027663
Gene Namezinc finger matrin type 3
SynonymsWig1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R8316 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location32334792-32366014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32341521 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 279 (Y279C)
Ref Sequence ENSEMBL: ENSMUSP00000131317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029199] [ENSMUST00000168566]
Predicted Effect probably damaging
Transcript: ENSMUST00000029199
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029199
Gene: ENSMUSG00000027663
AA Change: Y279C

DomainStartEndE-ValueType
ZnF_U1 67 101 1.03e-10 SMART
ZnF_C2H2 70 94 9.46e0 SMART
ZnF_U1 145 179 1.11e-10 SMART
ZnF_C2H2 148 172 5.54e1 SMART
ZnF_U1 243 277 7.72e-10 SMART
ZnF_C2H2 246 270 6.92e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168566
AA Change: Y279C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131317
Gene: ENSMUSG00000027663
AA Change: Y279C

DomainStartEndE-ValueType
ZnF_U1 67 101 1.03e-10 SMART
ZnF_C2H2 70 94 9.46e0 SMART
ZnF_U1 145 179 1.11e-10 SMART
ZnF_C2H2 148 172 5.54e1 SMART
ZnF_U1 243 277 7.72e-10 SMART
ZnF_C2H2 246 270 6.92e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing three zinc finger domains and a nuclear localization signal. The mRNA and the protein of this gene are upregulated by wildtype p53 and overexpression of this gene inhibits tumor cell growth, suggesting that this gene may have a role in the p53-dependent growth regulatory pathway. Alternative splicing of this gene results in two transcript variants encoding two isoforms differing in only one amino acid. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A C 10: 79,067,739 C248G probably damaging Het
4933427D14Rik A T 11: 72,168,786 V693E possibly damaging Het
Abcc10 G T 17: 46,327,809 L42I probably damaging Het
Alb A G 5: 90,468,590 E318G probably benign Het
Aox4 T A 1: 58,254,311 C941S possibly damaging Het
Aqp9 A G 9: 71,138,213 V38A probably benign Het
AW209491 A G 13: 14,637,764 T401A probably damaging Het
Ccdc173 A G 2: 69,781,943 probably null Het
Ccdc57 C T 11: 120,885,916 A553T probably damaging Het
Celf2 C T 2: 6,547,103 D522N probably benign Het
Cmpk2 A G 12: 26,474,137 N311S probably damaging Het
Dcn T C 10: 97,495,077 I91T probably damaging Het
Defa30 G A 8: 21,134,693 V11I probably benign Het
Dnmt3a T A 12: 3,896,965 V397E probably benign Het
Ehhadh G A 16: 21,766,303 A276V probably benign Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Gm8909 A G 17: 36,168,262 S32P unknown Het
Gpr156 A G 16: 37,997,974 D344G probably null Het
Invs G T 4: 48,426,199 R995S possibly damaging Het
Itpr3 T C 17: 27,106,225 M1264T possibly damaging Het
Lzic C T 4: 149,488,070 A39V probably benign Het
March6 A G 15: 31,482,504 L516P possibly damaging Het
Mecom C T 3: 29,957,380 E591K probably benign Het
Mical3 T C 6: 120,934,983 D1916G probably damaging Het
Mms22l T C 4: 24,578,855 I738T probably damaging Het
Mroh2b G A 15: 4,951,264 W1438* probably null Het
Mroh8 G T 2: 157,229,959 T542K possibly damaging Het
Msl1 A T 11: 98,800,248 K416I probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Olfr467 G T 7: 107,814,823 V82F possibly damaging Het
Olfr482 A G 7: 108,095,243 F109S probably benign Het
Olfr642 A T 7: 104,049,622 V244E probably damaging Het
Olfr814 A G 10: 129,874,022 V245A probably damaging Het
Pdzk1ip1 T A 4: 115,089,126 V61D probably benign Het
Plcxd1 A T 5: 110,102,314 M212L probably benign Het
Pld1 A G 3: 28,024,212 T7A probably benign Het
Ppm1n T C 7: 19,278,377 D310G probably damaging Het
Prpf8 A G 11: 75,499,815 N1264S possibly damaging Het
Pum2 T A 12: 8,713,456 N204K possibly damaging Het
Recql5 G A 11: 115,894,035 T822I possibly damaging Het
Rfc1 T C 5: 65,278,734 T656A probably benign Het
Sacs T C 14: 61,189,619 Y159H possibly damaging Het
Sept14 A G 5: 129,696,130 S148P probably damaging Het
Slco1c1 T A 6: 141,546,914 M341K probably benign Het
Spata9 C A 13: 75,977,771 S124R possibly damaging Het
Sri A G 5: 8,063,317 N103D probably damaging Het
Sspo G A 6: 48,482,688 C3327Y probably damaging Het
Trank1 A G 9: 111,349,302 M353V probably benign Het
Trim80 A T 11: 115,441,180 E66V probably damaging Het
Txndc16 A G 14: 45,211,184 L73P probably damaging Het
Ugt2b34 T A 5: 86,891,390 M471L probably damaging Het
Ush2a G T 1: 188,446,702 V1357L probably benign Het
Usp15 G T 10: 123,123,943 P855T Het
Uspl1 C T 5: 149,198,681 T290I possibly damaging Het
Zbtb2 A C 10: 4,369,084 M314R probably benign Het
Zcchc2 A G 1: 106,032,114 Y1151C probably damaging Het
Other mutations in Zmat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Zmat3 APN 3 32341678 missense possibly damaging 0.82
IGL01687:Zmat3 APN 3 32341531 missense probably damaging 1.00
IGL02251:Zmat3 APN 3 32345583 splice site probably benign
IGL03110:Zmat3 APN 3 32345552 missense probably damaging 0.98
R0585:Zmat3 UTSW 3 32361105 missense probably damaging 0.96
R1258:Zmat3 UTSW 3 32343671 missense probably damaging 0.99
R1916:Zmat3 UTSW 3 32343348 missense probably benign 0.00
R1968:Zmat3 UTSW 3 32360982 missense probably damaging 1.00
R4805:Zmat3 UTSW 3 32343355 missense probably benign 0.00
R4906:Zmat3 UTSW 3 32343687 missense probably damaging 1.00
R6252:Zmat3 UTSW 3 32341621 missense possibly damaging 0.55
R6844:Zmat3 UTSW 3 32341495 missense probably damaging 1.00
R7998:Zmat3 UTSW 3 32341666 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GAGCATCCTGGTGACCAAAG -3'
(R):5'- TCAGCAGGCCCTTACTTCAATG -3'

Sequencing Primer
(F):5'- TCCTGGTGACCAAAGAAACG -3'
(R):5'- ACTTCAATGCCCGCTCCCG -3'
Posted On2020-07-28