Incidental Mutation 'R8316:Aqp9'
ID641696
Institutional Source Beutler Lab
Gene Symbol Aqp9
Ensembl Gene ENSMUSG00000032204
Gene Nameaquaporin 9
Synonyms1700020I22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R8316 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location71110659-71168682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71138213 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 38 (V38A)
Ref Sequence ENSEMBL: ENSMUSP00000116785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060917] [ENSMUST00000074465] [ENSMUST00000113570] [ENSMUST00000144618]
Predicted Effect probably benign
Transcript: ENSMUST00000060917
AA Change: V64A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000050127
Gene: ENSMUSG00000032204
AA Change: V64A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:MIP 58 288 1.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074465
AA Change: V38A

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074063
Gene: ENSMUSG00000032204
AA Change: V38A

DomainStartEndE-ValueType
Pfam:MIP 17 262 4.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113570
AA Change: V38A

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109200
Gene: ENSMUSG00000032204
AA Change: V38A

DomainStartEndE-ValueType
Pfam:MIP 17 262 4.5e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144618
AA Change: V38A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116785
Gene: ENSMUSG00000032204
AA Change: V38A

DomainStartEndE-ValueType
Pfam:MIP 17 164 9.4e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: This gene encodes a member of the aquaglyceroporin subfamily of aquaporins. This protein transports water, glycerol, urea, purines and pyrimidines and plays a role in glycerol metabolism and osteoclast differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a null allele have increased glycerol and triglyceride levels, increased resistance to glycerol-induced lysis, decreased glycerol permeability, and decreased susceptibility to the early stages of parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A C 10: 79,067,739 C248G probably damaging Het
4933427D14Rik A T 11: 72,168,786 V693E possibly damaging Het
Abcc10 G T 17: 46,327,809 L42I probably damaging Het
Alb A G 5: 90,468,590 E318G probably benign Het
Aox4 T A 1: 58,254,311 C941S possibly damaging Het
AW209491 A G 13: 14,637,764 T401A probably damaging Het
Ccdc173 A G 2: 69,781,943 probably null Het
Ccdc57 C T 11: 120,885,916 A553T probably damaging Het
Celf2 C T 2: 6,547,103 D522N probably benign Het
Cmpk2 A G 12: 26,474,137 N311S probably damaging Het
Dcn T C 10: 97,495,077 I91T probably damaging Het
Defa30 G A 8: 21,134,693 V11I probably benign Het
Dnmt3a T A 12: 3,896,965 V397E probably benign Het
Ehhadh G A 16: 21,766,303 A276V probably benign Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fibcd1 T C 2: 31,833,779 probably benign Het
Gm8909 A G 17: 36,168,262 S32P unknown Het
Gpr156 A G 16: 37,997,974 D344G probably null Het
Invs G T 4: 48,426,199 R995S possibly damaging Het
Itpr3 T C 17: 27,106,225 M1264T possibly damaging Het
Lzic C T 4: 149,488,070 A39V probably benign Het
March6 A G 15: 31,482,504 L516P possibly damaging Het
Mecom C T 3: 29,957,380 E591K probably benign Het
Mical3 T C 6: 120,934,983 D1916G probably damaging Het
Mms22l T C 4: 24,578,855 I738T probably damaging Het
Mroh2b G A 15: 4,951,264 W1438* probably null Het
Mroh8 G T 2: 157,229,959 T542K possibly damaging Het
Msl1 A T 11: 98,800,248 K416I probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Olfr467 G T 7: 107,814,823 V82F possibly damaging Het
Olfr482 A G 7: 108,095,243 F109S probably benign Het
Olfr642 A T 7: 104,049,622 V244E probably damaging Het
Olfr814 A G 10: 129,874,022 V245A probably damaging Het
Pdzk1ip1 T A 4: 115,089,126 V61D probably benign Het
Plcxd1 A T 5: 110,102,314 M212L probably benign Het
Pld1 A G 3: 28,024,212 T7A probably benign Het
Ppm1n T C 7: 19,278,377 D310G probably damaging Het
Prpf8 A G 11: 75,499,815 N1264S possibly damaging Het
Pum2 T A 12: 8,713,456 N204K possibly damaging Het
Recql5 G A 11: 115,894,035 T822I possibly damaging Het
Rfc1 T C 5: 65,278,734 T656A probably benign Het
Sacs T C 14: 61,189,619 Y159H possibly damaging Het
Sept14 A G 5: 129,696,130 S148P probably damaging Het
Slco1c1 T A 6: 141,546,914 M341K probably benign Het
Smok2a T C 17: 13,226,273 S246P probably damaging Het
Spata9 C A 13: 75,977,771 S124R possibly damaging Het
Sri A G 5: 8,063,317 N103D probably damaging Het
Sspo G A 6: 48,482,688 C3327Y probably damaging Het
Trank1 A G 9: 111,349,302 M353V probably benign Het
Trim80 A T 11: 115,441,180 E66V probably damaging Het
Txndc16 A G 14: 45,211,184 L73P probably damaging Het
Ugt2b34 T A 5: 86,891,390 M471L probably damaging Het
Ush2a G T 1: 188,446,702 V1357L probably benign Het
Usp15 G T 10: 123,123,943 P855T Het
Uspl1 C T 5: 149,198,681 T290I possibly damaging Het
Zbtb2 A C 10: 4,369,084 M314R probably benign Het
Zcchc2 A G 1: 106,032,114 Y1151C probably damaging Het
Zmat3 T C 3: 32,341,521 Y279C probably damaging Het
Other mutations in Aqp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Aqp9 APN 9 71132731 missense probably damaging 1.00
IGL01012:Aqp9 APN 9 71130549 splice site probably benign
IGL01667:Aqp9 APN 9 71138213 missense probably benign 0.13
IGL02225:Aqp9 APN 9 71130547 splice site probably benign
IGL02389:Aqp9 APN 9 71122906 missense possibly damaging 0.80
IGL02551:Aqp9 APN 9 71132640 missense probably damaging 0.98
IGL02904:Aqp9 APN 9 71138148 missense probably damaging 0.98
R0411:Aqp9 UTSW 9 71130444 missense probably benign 0.00
R0751:Aqp9 UTSW 9 71138205 missense probably damaging 1.00
R1656:Aqp9 UTSW 9 71138103 missense probably benign 0.01
R1731:Aqp9 UTSW 9 71122968 missense possibly damaging 0.91
R1733:Aqp9 UTSW 9 71112342 missense possibly damaging 0.67
R1865:Aqp9 UTSW 9 71112376 missense probably benign 0.29
R4058:Aqp9 UTSW 9 71130444 missense probably benign 0.00
R4756:Aqp9 UTSW 9 71163049 missense probably damaging 1.00
R4771:Aqp9 UTSW 9 71122870 missense probably damaging 1.00
R4904:Aqp9 UTSW 9 71162403 intron probably benign
R5334:Aqp9 UTSW 9 71123010 critical splice acceptor site probably null
R5511:Aqp9 UTSW 9 71163093 utr 5 prime probably benign
R5771:Aqp9 UTSW 9 71122864 missense probably damaging 1.00
R6329:Aqp9 UTSW 9 71132684 nonsense probably null
R6831:Aqp9 UTSW 9 71162420 intron probably benign
R6838:Aqp9 UTSW 9 71112216 missense probably benign 0.41
R7337:Aqp9 UTSW 9 71162482 missense probably benign 0.23
R7466:Aqp9 UTSW 9 71163261 splice site probably null
R7946:Aqp9 UTSW 9 71123008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGCAACATTGTTGAGCTC -3'
(R):5'- TAAGATTCATTCACCTGTGGCC -3'

Sequencing Primer
(F):5'- ACACTGCCAGCACATTAGGACTG -3'
(R):5'- ATTCACCTGTGGCCTGGGAG -3'
Posted On2020-07-28