Incidental Mutation 'R8316:Recql5'
ID641707
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene NameRecQ protein-like 5
SynonymsRecq5b, Recql5b
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R8316 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115892595-115933477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115894035 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 822 (T822I)
Ref Sequence ENSEMBL: ENSMUSP00000021097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000093911] [ENSMUST00000131578] [ENSMUST00000140174] [ENSMUST00000167507]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021097
AA Change: T822I

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: T822I

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A C 10: 79,067,739 C248G probably damaging Het
4933427D14Rik A T 11: 72,168,786 V693E possibly damaging Het
Abcc10 G T 17: 46,327,809 L42I probably damaging Het
Alb A G 5: 90,468,590 E318G probably benign Het
Aox4 T A 1: 58,254,311 C941S possibly damaging Het
Aqp9 A G 9: 71,138,213 V38A probably benign Het
AW209491 A G 13: 14,637,764 T401A probably damaging Het
Ccdc173 A G 2: 69,781,943 probably null Het
Ccdc57 C T 11: 120,885,916 A553T probably damaging Het
Celf2 C T 2: 6,547,103 D522N probably benign Het
Cmpk2 A G 12: 26,474,137 N311S probably damaging Het
Dcn T C 10: 97,495,077 I91T probably damaging Het
Defa30 G A 8: 21,134,693 V11I probably benign Het
Dnmt3a T A 12: 3,896,965 V397E probably benign Het
Ehhadh G A 16: 21,766,303 A276V probably benign Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Gm8909 A G 17: 36,168,262 S32P unknown Het
Gpr156 A G 16: 37,997,974 D344G probably null Het
Invs G T 4: 48,426,199 R995S possibly damaging Het
Itpr3 T C 17: 27,106,225 M1264T possibly damaging Het
Lzic C T 4: 149,488,070 A39V probably benign Het
March6 A G 15: 31,482,504 L516P possibly damaging Het
Mecom C T 3: 29,957,380 E591K probably benign Het
Mical3 T C 6: 120,934,983 D1916G probably damaging Het
Mms22l T C 4: 24,578,855 I738T probably damaging Het
Mroh2b G A 15: 4,951,264 W1438* probably null Het
Mroh8 G T 2: 157,229,959 T542K possibly damaging Het
Msl1 A T 11: 98,800,248 K416I probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Olfr467 G T 7: 107,814,823 V82F possibly damaging Het
Olfr482 A G 7: 108,095,243 F109S probably benign Het
Olfr642 A T 7: 104,049,622 V244E probably damaging Het
Olfr814 A G 10: 129,874,022 V245A probably damaging Het
Pdzk1ip1 T A 4: 115,089,126 V61D probably benign Het
Plcxd1 A T 5: 110,102,314 M212L probably benign Het
Pld1 A G 3: 28,024,212 T7A probably benign Het
Ppm1n T C 7: 19,278,377 D310G probably damaging Het
Prpf8 A G 11: 75,499,815 N1264S possibly damaging Het
Pum2 T A 12: 8,713,456 N204K possibly damaging Het
Rfc1 T C 5: 65,278,734 T656A probably benign Het
Sacs T C 14: 61,189,619 Y159H possibly damaging Het
Sept14 A G 5: 129,696,130 S148P probably damaging Het
Slco1c1 T A 6: 141,546,914 M341K probably benign Het
Spata9 C A 13: 75,977,771 S124R possibly damaging Het
Sri A G 5: 8,063,317 N103D probably damaging Het
Sspo G A 6: 48,482,688 C3327Y probably damaging Het
Trank1 A G 9: 111,349,302 M353V probably benign Het
Trim80 A T 11: 115,441,180 E66V probably damaging Het
Txndc16 A G 14: 45,211,184 L73P probably damaging Het
Ugt2b34 T A 5: 86,891,390 M471L probably damaging Het
Ush2a G T 1: 188,446,702 V1357L probably benign Het
Usp15 G T 10: 123,123,943 P855T Het
Uspl1 C T 5: 149,198,681 T290I possibly damaging Het
Zbtb2 A C 10: 4,369,084 M314R probably benign Het
Zcchc2 A G 1: 106,032,114 Y1151C probably damaging Het
Zmat3 T C 3: 32,341,521 Y279C probably damaging Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0152:Recql5 UTSW 11 115894673 missense probably benign
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0786:Recql5 UTSW 11 115895802 missense probably benign
R0975:Recql5 UTSW 11 115923256 missense probably damaging 1.00
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1807:Recql5 UTSW 11 115895115 missense possibly damaging 0.63
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1935:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2012:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2023:Recql5 UTSW 11 115893640 missense probably benign
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5323:Recql5 UTSW 11 115927389 missense probably damaging 1.00
R5796:Recql5 UTSW 11 115927865 intron probably benign
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
R7503:Recql5 UTSW 11 115895055 missense probably benign 0.00
R7574:Recql5 UTSW 11 115928422 missense probably benign
R7597:Recql5 UTSW 11 115928381 missense probably benign 0.03
R7658:Recql5 UTSW 11 115923276 missense probably damaging 1.00
R8025:Recql5 UTSW 11 115928112 missense probably damaging 1.00
R8038:Recql5 UTSW 11 115927352 missense possibly damaging 0.90
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTGCTGCTGGAGTATGAG -3'
(R):5'- TATTTCAGACTGAGGGTCCCAGG -3'

Sequencing Primer
(F):5'- TGAGAAGTGATTTTCCCCGAACC -3'
(R):5'- TCCCAGGGAGAGGCCAAG -3'
Posted On2020-07-28