Mutagenetix > Incidental Mutations

Incidental Mutation 'R8316:Mroh2b'

641717

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R8316 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 4951264 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 1438 (W1438*)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

Predicted Effect

probably null
Transcript: ENSMUST00000045736
AA Change: W1438*

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: W1438*

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (56/57)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	A	C	10: 79,067,739	C248G	probably damaging	Het
4933427D14Rik	A	T	11: 72,168,786	V693E	possibly damaging	Het
Abcc10	G	T	17: 46,327,809	L42I	probably damaging	Het
Alb	A	G	5: 90,468,590	E318G	probably benign	Het
Aox4	T	A	1: 58,254,311	C941S	possibly damaging	Het
Aqp9	A	G	9: 71,138,213	V38A	probably benign	Het
AW209491	A	G	13: 14,637,764	T401A	probably damaging	Het
Ccdc173	A	G	2: 69,781,943		probably null	Het
Ccdc57	C	T	11: 120,885,916	A553T	probably damaging	Het
Celf2	C	T	2: 6,547,103	D522N	probably benign	Het
Cmpk2	A	G	12: 26,474,137	N311S	probably damaging	Het
Dcn	T	C	10: 97,495,077	I91T	probably damaging	Het
Defa30	G	A	8: 21,134,693	V11I	probably benign	Het
Dnmt3a	T	A	12: 3,896,965	V397E	probably benign	Het
Ehhadh	G	A	16: 21,766,303	A276V	probably benign	Het
Fam150b	G	T	12: 30,884,851	G23V	probably damaging	Het
Fibcd1	T	C	2: 31,833,779		probably benign	Het
Gm8909	A	G	17: 36,168,262	S32P	unknown	Het
Gpr156	A	G	16: 37,997,974	D344G	probably null	Het
Invs	G	T	4: 48,426,199	R995S	possibly damaging	Het
Itpr3	T	C	17: 27,106,225	M1264T	possibly damaging	Het
Lzic	C	T	4: 149,488,070	A39V	probably benign	Het
March6	A	G	15: 31,482,504	L516P	possibly damaging	Het
Mecom	C	T	3: 29,957,380	E591K	probably benign	Het
Mical3	T	C	6: 120,934,983	D1916G	probably damaging	Het
Mms22l	T	C	4: 24,578,855	I738T	probably damaging	Het
Mroh8	G	T	2: 157,229,959	T542K	possibly damaging	Het
Msl1	A	T	11: 98,800,248	K416I	probably damaging	Het
Myh15	C	A	16: 49,120,018	T777N	probably damaging	Het
Olfr467	G	T	7: 107,814,823	V82F	possibly damaging	Het
Olfr482	A	G	7: 108,095,243	F109S	probably benign	Het
Olfr642	A	T	7: 104,049,622	V244E	probably damaging	Het
Olfr814	A	G	10: 129,874,022	V245A	probably damaging	Het
Pdzk1ip1	T	A	4: 115,089,126	V61D	probably benign	Het
Plcxd1	A	T	5: 110,102,314	M212L	probably benign	Het
Pld1	A	G	3: 28,024,212	T7A	probably benign	Het
Ppm1n	T	C	7: 19,278,377	D310G	probably damaging	Het
Prpf8	A	G	11: 75,499,815	N1264S	possibly damaging	Het
Pum2	T	A	12: 8,713,456	N204K	possibly damaging	Het
Recql5	G	A	11: 115,894,035	T822I	possibly damaging	Het
Rfc1	T	C	5: 65,278,734	T656A	probably benign	Het
Sacs	T	C	14: 61,189,619	Y159H	possibly damaging	Het
Sept14	A	G	5: 129,696,130	S148P	probably damaging	Het
Slco1c1	T	A	6: 141,546,914	M341K	probably benign	Het
Smok2a	T	C	17: 13,226,273	S246P	probably damaging	Het
Spata9	C	A	13: 75,977,771	S124R	possibly damaging	Het
Sri	A	G	5: 8,063,317	N103D	probably damaging	Het
Sspo	G	A	6: 48,482,688	C3327Y	probably damaging	Het
Trank1	A	G	9: 111,349,302	M353V	probably benign	Het
Trim80	A	T	11: 115,441,180	E66V	probably damaging	Het
Txndc16	A	G	14: 45,211,184	L73P	probably damaging	Het
Ugt2b34	T	A	5: 86,891,390	M471L	probably damaging	Het
Ush2a	G	T	1: 188,446,702	V1357L	probably benign	Het
Usp15	G	T	10: 123,123,943	P855T		Het
Uspl1	C	T	5: 149,198,681	T290I	possibly damaging	Het
Zbtb2	A	C	10: 4,369,084	M314R	probably benign	Het
Zcchc2	A	G	1: 106,032,114	Y1151C	probably damaging	Het
Zmat3	T	C	3: 32,341,521	Y279C	probably damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAAAGGGTGCCAGTAGTG -3'
(R):5'- AGACATCACGGCATGCCTAG -3'

Sequencing Primer
(F):5'- AAGGGTGCCAGTAGTGAATTTCC -3'
(R):5'- AGTCTACAACATCTGTCATAAGGG -3'

Posted On

2020-07-28