Incidental Mutation 'R8316:Mroh2b'
ID641717
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R8316 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 4951264 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 1438 (W1438*)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably null
Transcript: ENSMUST00000045736
AA Change: W1438*
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: W1438*

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A C 10: 79,067,739 C248G probably damaging Het
4933427D14Rik A T 11: 72,168,786 V693E possibly damaging Het
Abcc10 G T 17: 46,327,809 L42I probably damaging Het
Alb A G 5: 90,468,590 E318G probably benign Het
Aox4 T A 1: 58,254,311 C941S possibly damaging Het
Aqp9 A G 9: 71,138,213 V38A probably benign Het
AW209491 A G 13: 14,637,764 T401A probably damaging Het
Ccdc173 A G 2: 69,781,943 probably null Het
Ccdc57 C T 11: 120,885,916 A553T probably damaging Het
Celf2 C T 2: 6,547,103 D522N probably benign Het
Cmpk2 A G 12: 26,474,137 N311S probably damaging Het
Dcn T C 10: 97,495,077 I91T probably damaging Het
Defa30 G A 8: 21,134,693 V11I probably benign Het
Dnmt3a T A 12: 3,896,965 V397E probably benign Het
Ehhadh G A 16: 21,766,303 A276V probably benign Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fibcd1 T C 2: 31,833,779 probably benign Het
Gm8909 A G 17: 36,168,262 S32P unknown Het
Gpr156 A G 16: 37,997,974 D344G probably null Het
Invs G T 4: 48,426,199 R995S possibly damaging Het
Itpr3 T C 17: 27,106,225 M1264T possibly damaging Het
Lzic C T 4: 149,488,070 A39V probably benign Het
March6 A G 15: 31,482,504 L516P possibly damaging Het
Mecom C T 3: 29,957,380 E591K probably benign Het
Mical3 T C 6: 120,934,983 D1916G probably damaging Het
Mms22l T C 4: 24,578,855 I738T probably damaging Het
Mroh8 G T 2: 157,229,959 T542K possibly damaging Het
Msl1 A T 11: 98,800,248 K416I probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Olfr467 G T 7: 107,814,823 V82F possibly damaging Het
Olfr482 A G 7: 108,095,243 F109S probably benign Het
Olfr642 A T 7: 104,049,622 V244E probably damaging Het
Olfr814 A G 10: 129,874,022 V245A probably damaging Het
Pdzk1ip1 T A 4: 115,089,126 V61D probably benign Het
Plcxd1 A T 5: 110,102,314 M212L probably benign Het
Pld1 A G 3: 28,024,212 T7A probably benign Het
Ppm1n T C 7: 19,278,377 D310G probably damaging Het
Prpf8 A G 11: 75,499,815 N1264S possibly damaging Het
Pum2 T A 12: 8,713,456 N204K possibly damaging Het
Recql5 G A 11: 115,894,035 T822I possibly damaging Het
Rfc1 T C 5: 65,278,734 T656A probably benign Het
Sacs T C 14: 61,189,619 Y159H possibly damaging Het
Sept14 A G 5: 129,696,130 S148P probably damaging Het
Slco1c1 T A 6: 141,546,914 M341K probably benign Het
Smok2a T C 17: 13,226,273 S246P probably damaging Het
Spata9 C A 13: 75,977,771 S124R possibly damaging Het
Sri A G 5: 8,063,317 N103D probably damaging Het
Sspo G A 6: 48,482,688 C3327Y probably damaging Het
Trank1 A G 9: 111,349,302 M353V probably benign Het
Trim80 A T 11: 115,441,180 E66V probably damaging Het
Txndc16 A G 14: 45,211,184 L73P probably damaging Het
Ugt2b34 T A 5: 86,891,390 M471L probably damaging Het
Ush2a G T 1: 188,446,702 V1357L probably benign Het
Usp15 G T 10: 123,123,943 P855T Het
Uspl1 C T 5: 149,198,681 T290I possibly damaging Het
Zbtb2 A C 10: 4,369,084 M314R probably benign Het
Zcchc2 A G 1: 106,032,114 Y1151C probably damaging Het
Zmat3 T C 3: 32,341,521 Y279C probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAAAGGGTGCCAGTAGTG -3'
(R):5'- AGACATCACGGCATGCCTAG -3'

Sequencing Primer
(F):5'- AAGGGTGCCAGTAGTGAATTTCC -3'
(R):5'- AGTCTACAACATCTGTCATAAGGG -3'
Posted On2020-07-28