Incidental Mutation 'R8317:Adipor1'
ID641726
Institutional Source Beutler Lab
Gene Symbol Adipor1
Ensembl Gene ENSMUSG00000026457
Gene Nameadiponectin receptor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location134415378-134433351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134428167 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 235 (R235W)
Ref Sequence ENSEMBL: ENSMUSP00000027727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027727] [ENSMUST00000112237]
Predicted Effect probably benign
Transcript: ENSMUST00000027727
AA Change: R235W

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027727
Gene: ENSMUSG00000026457
AA Change: R235W

DomainStartEndE-ValueType
Blast:RING 72 127 2e-31 BLAST
Pfam:HlyIII 129 352 2.2e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112237
AA Change: R235W

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107856
Gene: ENSMUSG00000026457
AA Change: R235W

DomainStartEndE-ValueType
Blast:RING 72 127 2e-31 BLAST
Pfam:HlyIII 129 352 7.4e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor for the fat-derived hormone adiponectin. Binding of adiponectin to the encoded protein results in activation of an AMP-activated kinase signaling pathway which affects levels of fatty acid oxidation and insulin sensitivity. Homozygous knockout mice for this gene exhibit elevated plasma glucose and insulin levels as well as impaired glucose tolerance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal homeostasis, adipose tissue morphology and adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Adipor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Adipor1 APN 1 134431185 missense probably benign 0.07
IGL02186:Adipor1 APN 1 134425960 missense probably benign 0.02
IGL03365:Adipor1 APN 1 134431642 missense possibly damaging 0.67
BB001:Adipor1 UTSW 1 134425993 missense probably damaging 1.00
BB011:Adipor1 UTSW 1 134425993 missense probably damaging 1.00
R0898:Adipor1 UTSW 1 134424076 critical splice donor site probably null
R1625:Adipor1 UTSW 1 134424064 missense possibly damaging 0.88
R1938:Adipor1 UTSW 1 134423103 missense probably benign 0.03
R1956:Adipor1 UTSW 1 134423033 missense probably benign 0.00
R1957:Adipor1 UTSW 1 134423033 missense probably benign 0.00
R1958:Adipor1 UTSW 1 134423033 missense probably benign 0.00
R2921:Adipor1 UTSW 1 134425993 missense possibly damaging 0.90
R4666:Adipor1 UTSW 1 134424905 missense probably damaging 1.00
R5560:Adipor1 UTSW 1 134426040 missense possibly damaging 0.69
R5795:Adipor1 UTSW 1 134424903 missense probably damaging 1.00
R7924:Adipor1 UTSW 1 134425993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGTCAGGTCTGGGTGCAG -3'
(R):5'- TTGTAACTGTTATGTCCAGCCC -3'

Sequencing Primer
(F):5'- TCTGGGTGCAGGTGAGAGAC -3'
(R):5'- TCTAGACCCCTTGGAAGGTTGAAC -3'
Posted On2020-07-28