Incidental Mutation 'R8317:Pappa2'
ID641727
Institutional Source Beutler Lab
Gene Symbol Pappa2
Ensembl Gene ENSMUSG00000073530
Gene Namepappalysin 2
Synonymspregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location158711727-158980490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 158764960 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1616 (C1616R)
Ref Sequence ENSEMBL: ENSMUSP00000124022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159861]
Predicted Effect probably damaging
Transcript: ENSMUST00000159861
AA Change: C1616R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: C1616R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Laminin_G_3 271 440 1.2e-25 PFAM
NL 572 614 2.81e-5 SMART
Pfam:Peptidase_M43 669 832 1.5e-12 PFAM
Blast:FN3 844 1103 1e-169 BLAST
low complexity region 1130 1139 N/A INTRINSIC
low complexity region 1361 1370 N/A INTRINSIC
CCP 1394 1457 4.97e0 SMART
CCP 1462 1519 4.81e-1 SMART
CCP 1523 1588 2.58e-4 SMART
CCP 1593 1644 1.13e0 SMART
NL 1720 1757 2.66e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161589
SMART Domains Protein: ENSMUSP00000124316
Gene: ENSMUSG00000073530

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
CCP 67 130 4.97e0 SMART
CCP 135 192 4.81e-1 SMART
CCP 196 245 2.84e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Pappa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Pappa2 APN 1 158857148 missense probably damaging 1.00
IGL01394:Pappa2 APN 1 158765104 splice site probably benign
IGL01570:Pappa2 APN 1 158814540 nonsense probably null
IGL01618:Pappa2 APN 1 158857378 missense probably damaging 1.00
IGL01717:Pappa2 APN 1 158857132 critical splice donor site probably null
IGL01804:Pappa2 APN 1 158936519 missense probably benign
IGL01904:Pappa2 APN 1 158783941 missense probably damaging 0.99
IGL02116:Pappa2 APN 1 158845125 missense probably benign 0.01
IGL02174:Pappa2 APN 1 158761618 missense probably damaging 1.00
IGL02302:Pappa2 APN 1 158715001 missense probably benign 0.38
IGL02422:Pappa2 APN 1 158936933 missense probably damaging 1.00
IGL02572:Pappa2 APN 1 158851216 missense probably benign
IGL02659:Pappa2 APN 1 158936794 missense probably damaging 0.97
IGL02887:Pappa2 APN 1 158782259 missense probably damaging 1.00
IGL02981:Pappa2 APN 1 158851144 missense probably benign 0.00
IGL03128:Pappa2 APN 1 158936484 missense probably benign 0.16
IGL03142:Pappa2 APN 1 158854931 missense probably damaging 1.00
IGL03270:Pappa2 APN 1 158765067 missense possibly damaging 0.78
Gulliver UTSW 1 158857136 missense probably null 1.00
Lilliputian UTSW 1 158716990 missense probably damaging 1.00
Lilliputian2 UTSW 1 158834918 nonsense probably null
lilliputian3 UTSW 1 158782403 splice site probably null
Pitzel UTSW 1 158956645 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0172:Pappa2 UTSW 1 158854849 critical splice donor site probably null
R0194:Pappa2 UTSW 1 158765101 splice site probably benign
R0418:Pappa2 UTSW 1 158716990 missense probably damaging 1.00
R0421:Pappa2 UTSW 1 158848080 missense probably damaging 1.00
R0441:Pappa2 UTSW 1 158763058 unclassified probably benign
R0602:Pappa2 UTSW 1 158763055 unclassified probably benign
R0630:Pappa2 UTSW 1 158832773 missense probably benign
R0760:Pappa2 UTSW 1 158716961 critical splice donor site probably null
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1243:Pappa2 UTSW 1 158845100 missense probably damaging 1.00
R1413:Pappa2 UTSW 1 158936554 missense probably benign 0.00
R1502:Pappa2 UTSW 1 158957288 missense probably damaging 1.00
R1599:Pappa2 UTSW 1 158857172 missense probably damaging 1.00
R1689:Pappa2 UTSW 1 158957398 missense probably damaging 1.00
R1750:Pappa2 UTSW 1 158763150 nonsense probably null
R1772:Pappa2 UTSW 1 158814368 missense possibly damaging 0.92
R1832:Pappa2 UTSW 1 158857316 missense probably damaging 1.00
R1905:Pappa2 UTSW 1 158803503 splice site probably null
R1914:Pappa2 UTSW 1 158750563 missense probably damaging 0.97
R2013:Pappa2 UTSW 1 158834928 missense probably damaging 1.00
R2037:Pappa2 UTSW 1 158956644 nonsense probably null
R2118:Pappa2 UTSW 1 158857266 missense probably damaging 1.00
R2268:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2269:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2347:Pappa2 UTSW 1 158765043 missense probably damaging 1.00
R3024:Pappa2 UTSW 1 158936225 missense probably benign 0.00
R3706:Pappa2 UTSW 1 158834918 nonsense probably null
R3707:Pappa2 UTSW 1 158834918 nonsense probably null
R3708:Pappa2 UTSW 1 158834918 nonsense probably null
R4600:Pappa2 UTSW 1 158814445 missense probably damaging 1.00
R4737:Pappa2 UTSW 1 158957012 missense probably benign
R4738:Pappa2 UTSW 1 158957012 missense probably benign
R4739:Pappa2 UTSW 1 158957002 missense probably damaging 0.99
R4739:Pappa2 UTSW 1 158957012 missense probably benign
R4788:Pappa2 UTSW 1 158783917 missense possibly damaging 0.86
R4798:Pappa2 UTSW 1 158857379 missense probably damaging 0.99
R4952:Pappa2 UTSW 1 158857136 missense probably null 1.00
R5121:Pappa2 UTSW 1 158838627 missense probably benign 0.01
R5144:Pappa2 UTSW 1 158957133 missense probably benign 0.03
R5159:Pappa2 UTSW 1 158761619 missense probably damaging 1.00
R5278:Pappa2 UTSW 1 158782403 splice site probably null
R5428:Pappa2 UTSW 1 158814785 missense possibly damaging 0.53
R5452:Pappa2 UTSW 1 158838602 missense probably benign 0.00
R5477:Pappa2 UTSW 1 158956738 missense probably benign 0.00
R5504:Pappa2 UTSW 1 158848045 missense probably benign 0.00
R5852:Pappa2 UTSW 1 158717014 missense probably damaging 1.00
R6003:Pappa2 UTSW 1 158936250 missense probably benign 0.23
R6129:Pappa2 UTSW 1 158714997 nonsense probably null
R6137:Pappa2 UTSW 1 158871543 missense probably damaging 1.00
R6374:Pappa2 UTSW 1 158956645 missense probably damaging 1.00
R6472:Pappa2 UTSW 1 158834799 missense probably damaging 1.00
R6804:Pappa2 UTSW 1 158936868 missense probably benign 0.24
R7020:Pappa2 UTSW 1 158848009 missense probably damaging 0.98
R7051:Pappa2 UTSW 1 158957183 missense unknown
R7082:Pappa2 UTSW 1 158763119 missense possibly damaging 0.65
R7111:Pappa2 UTSW 1 158956526 missense probably benign 0.38
R7213:Pappa2 UTSW 1 158936886 missense possibly damaging 0.93
R7575:Pappa2 UTSW 1 158814530 missense probably damaging 1.00
R7587:Pappa2 UTSW 1 158851131 missense probably damaging 1.00
R7826:Pappa2 UTSW 1 158936440 nonsense probably null
R7957:Pappa2 UTSW 1 158761561 nonsense probably null
R8007:Pappa2 UTSW 1 158782304 missense probably damaging 0.99
R8050:Pappa2 UTSW 1 158848400 missense probably damaging 1.00
R8063:Pappa2 UTSW 1 158936556 missense possibly damaging 0.79
R8068:Pappa2 UTSW 1 158935985 missense possibly damaging 0.87
R8128:Pappa2 UTSW 1 158936664 missense possibly damaging 0.75
R8264:Pappa2 UTSW 1 158854973 missense probably damaging 1.00
X0058:Pappa2 UTSW 1 158814397 missense probably null
X0061:Pappa2 UTSW 1 158936618 missense possibly damaging 0.87
Z1176:Pappa2 UTSW 1 158814814 missense probably damaging 1.00
Z1176:Pappa2 UTSW 1 158814816 missense probably damaging 1.00
Z1176:Pappa2 UTSW 1 158956933 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAACACGATTAGGAACTCTCCAGG -3'
(R):5'- ACACATTTCTGAGGGTCCAGTC -3'

Sequencing Primer
(F):5'- GGGAACAATATCAGTGCCTCTC -3'
(R):5'- CTGAGGGTCCAGTCTTTCCTTATG -3'
Posted On2020-07-28