Incidental Mutation 'R8317:Nebl'
ID641728
Institutional Source Beutler Lab
Gene Symbol Nebl
Ensembl Gene ENSMUSG00000053702
Gene Namenebulette
SynonymsLnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location17343909-17731464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17350757 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 195 (M195T)
Ref Sequence ENSEMBL: ENSMUSP00000028080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028080
AA Change: M195T

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702
AA Change: M195T

DomainStartEndE-ValueType
LIM 4 56 6.95e-14 SMART
NEBU 62 92 3.35e-8 SMART
NEBU 98 128 4.88e-10 SMART
NEBU 134 164 3.82e-3 SMART
SH3 213 270 2.12e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124270
AA Change: M939T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: M939T

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 1.57e0 SMART
NEBU 280 310 9.67e-1 SMART
NEBU 315 345 6.25e-8 SMART
NEBU 351 381 5.97e-5 SMART
NEBU 387 418 2.56e-4 SMART
NEBU 425 455 8.91e-4 SMART
NEBU 462 492 4.92e-6 SMART
NEBU 499 529 2.33e-7 SMART
NEBU 536 566 1.84e-5 SMART
NEBU 571 601 2.23e-4 SMART
NEBU 602 632 1.24e-2 SMART
NEBU 664 694 6.6e-7 SMART
NEBU 695 725 6.86e-5 SMART
NEBU 726 756 2.03e-7 SMART
NEBU 761 791 1.74e-6 SMART
NEBU 797 827 3.82e-3 SMART
SH3 957 1014 2.12e-20 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702
AA Change: M130T

DomainStartEndE-ValueType
NEBU 3 33 4.88e-10 SMART
NEBU 39 69 3.82e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Nebl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Nebl APN 2 17348868 missense probably damaging 0.99
IGL02732:Nebl APN 2 17452484 splice site probably benign
IGL03241:Nebl APN 2 17393164 critical splice donor site probably null
IGL03334:Nebl APN 2 17413711 missense probably damaging 0.98
BB008:Nebl UTSW 2 17376622 critical splice donor site probably null
BB018:Nebl UTSW 2 17376622 critical splice donor site probably null
R0068:Nebl UTSW 2 17434971 nonsense probably null
R0127:Nebl UTSW 2 17392983 missense probably benign 0.31
R0128:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17390926 start gained probably benign
R0537:Nebl UTSW 2 17404215 missense possibly damaging 0.62
R0743:Nebl UTSW 2 17411118 missense probably benign
R0884:Nebl UTSW 2 17411118 missense probably benign
R1364:Nebl UTSW 2 17393037 unclassified probably benign
R1638:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R1711:Nebl UTSW 2 17388754 missense probably damaging 0.96
R1933:Nebl UTSW 2 17375292 missense probably damaging 0.97
R1990:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1991:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1992:Nebl UTSW 2 17452510 missense probably damaging 0.98
R2062:Nebl UTSW 2 17397121 missense probably benign 0.39
R2183:Nebl UTSW 2 17404216 missense probably damaging 0.99
R2325:Nebl UTSW 2 17393016 missense possibly damaging 0.79
R2679:Nebl UTSW 2 17424591 missense probably benign 0.03
R2877:Nebl UTSW 2 17434929 missense probably damaging 0.99
R2878:Nebl UTSW 2 17434929 missense probably damaging 0.99
R3079:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3080:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3878:Nebl UTSW 2 17393252 missense possibly damaging 0.83
R3947:Nebl UTSW 2 17378106 critical splice donor site probably null
R4983:Nebl UTSW 2 17375271 missense possibly damaging 0.80
R5006:Nebl UTSW 2 17388771 splice site probably null
R5256:Nebl UTSW 2 17433975 missense probably benign 0.37
R5491:Nebl UTSW 2 17434972 nonsense probably null
R5533:Nebl UTSW 2 17393268 nonsense probably null
R5597:Nebl UTSW 2 17378167 missense probably benign
R5658:Nebl UTSW 2 17348852 missense probably damaging 1.00
R5933:Nebl UTSW 2 17404187 missense probably benign
R6056:Nebl UTSW 2 17450234 missense probably benign 0.13
R6161:Nebl UTSW 2 17730830 missense probably benign 0.26
R6646:Nebl UTSW 2 17376685 missense probably damaging 1.00
R6784:Nebl UTSW 2 17434914 nonsense probably null
R6935:Nebl UTSW 2 17348826 missense probably damaging 1.00
R7196:Nebl UTSW 2 17452518 missense probably damaging 1.00
R7671:Nebl UTSW 2 17390916 nonsense probably null
R7728:Nebl UTSW 2 17370514 missense
R7931:Nebl UTSW 2 17376622 critical splice donor site probably null
R8007:Nebl UTSW 2 17370489 missense
R8048:Nebl UTSW 2 17424522 missense probably benign 0.12
R8118:Nebl UTSW 2 17379820 missense possibly damaging 0.48
R8349:Nebl UTSW 2 17413782 missense probably damaging 0.98
R8360:Nebl UTSW 2 17460487 missense probably benign 0.04
R8392:Nebl UTSW 2 17452552 missense probably benign 0.36
R8449:Nebl UTSW 2 17413782 missense probably damaging 0.98
X0012:Nebl UTSW 2 17443794 missense probably benign 0.16
X0025:Nebl UTSW 2 17404267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTTTGCTTCCATTGAAAGGAC -3'
(R):5'- GCAGAAATTGACTGACATTTTGAGATC -3'

Sequencing Primer
(F):5'- TTGCTTCCATTGAAAGGACTATATAC -3'
(R):5'- GACTAATCTGGAGACTGCCTGTAC -3'
Posted On2020-07-28