Incidental Mutation 'R8317:Epb41'
ID641735
Institutional Source Beutler Lab
Gene Symbol Epb41
Ensembl Gene ENSMUSG00000028906
Gene Nameerythrocyte membrane protein band 4.1
SynonymsEpb4.1, 4.1R, D4Ertd442e, Elp1, Elp-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location131923413-132075321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 131957650 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 86 (G86V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030739] [ENSMUST00000054917] [ENSMUST00000084253] [ENSMUST00000105970] [ENSMUST00000105972] [ENSMUST00000105974] [ENSMUST00000105975] [ENSMUST00000105981] [ENSMUST00000137846] [ENSMUST00000141291]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030739
AA Change: G720V

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030739
Gene: ENSMUSG00000028906
AA Change: G720V

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054917
AA Change: G666V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060375
Gene: ENSMUSG00000028906
AA Change: G666V

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084253
AA Change: G666V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081274
Gene: ENSMUSG00000028906
AA Change: G666V

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105970
AA Change: G535V

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101590
Gene: ENSMUSG00000028906
AA Change: G535V

DomainStartEndE-ValueType
B41 55 250 1.3e-80 SMART
FERM_C 254 344 1.01e-35 SMART
FA 347 393 8.99e-19 SMART
low complexity region 437 459 N/A INTRINSIC
Pfam:SAB 476 524 1.1e-29 PFAM
Pfam:4_1_CTD 578 636 1.4e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105972
AA Change: G720V

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101592
Gene: ENSMUSG00000028906
AA Change: G720V

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105974
AA Change: G631V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101594
Gene: ENSMUSG00000028906
AA Change: G631V

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 367 3.77e-50 SMART
FERM_C 371 461 1.01e-35 SMART
FA 464 510 8.99e-19 SMART
Pfam:SAB 572 620 2e-28 PFAM
Pfam:4_1_CTD 652 766 3e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105975
AA Change: G731V

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101595
Gene: ENSMUSG00000028906
AA Change: G731V

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 232 427 1.3e-80 SMART
FERM_C 431 521 1.01e-35 SMART
FA 524 570 8.99e-19 SMART
low complexity region 619 632 N/A INTRINSIC
Pfam:SAB 672 720 3.9e-25 PFAM
Pfam:4_1_CTD 758 865 2.6e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105981
AA Change: G720V

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101601
Gene: ENSMUSG00000028906
AA Change: G720V

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121764
Gene: ENSMUSG00000028906
AA Change: G86V

DomainStartEndE-ValueType
Pfam:SAB 28 76 2e-24 PFAM
low complexity region 148 159 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
Pfam:4_1_CTD 264 371 6.6e-52 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137846
AA Change: G529V

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123623
Gene: ENSMUSG00000028906
AA Change: G529V

DomainStartEndE-ValueType
B41 49 244 1.3e-80 SMART
FERM_C 248 338 1.01e-35 SMART
FA 341 387 8.99e-19 SMART
low complexity region 431 453 N/A INTRINSIC
Pfam:SAB 470 518 1.2e-29 PFAM
Pfam:4_1_CTD 550 664 2.5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141291
AA Change: G706V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120236
Gene: ENSMUSG00000028906
AA Change: G706V

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 647 695 1.3e-29 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122234
Gene: ENSMUSG00000028906
AA Change: G111V

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
Pfam:SAB 53 101 7e-26 PFAM
Pfam:4_1_CTD 139 246 2.8e-52 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with spectrin and actin, constitute the red cell membrane cytoskeletal network. This complex plays a critical role in erythrocyte shape and deformability. Mutations in this gene are associated with type 1 elliptocytosis (EL1). Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit moderate hemolytic anemia, erythrocytic abnormalities including aberrant morphology, reduced membrane stability, and lowered expression of spectrin and ankyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Epb41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Epb41 APN 4 131974731 missense probably benign
IGL00897:Epb41 APN 4 132000197 splice site probably null
IGL00911:Epb41 APN 4 131989784 missense possibly damaging 0.60
IGL01390:Epb41 APN 4 132003737 missense probably benign
IGL01459:Epb41 APN 4 131964128 intron probably benign
IGL01816:Epb41 APN 4 132003695 missense probably benign 0.00
IGL02192:Epb41 APN 4 131929717 missense probably damaging 0.99
IGL02296:Epb41 APN 4 132003754 missense probably benign 0.42
IGL03011:Epb41 APN 4 132003794 missense probably damaging 1.00
IGL03268:Epb41 APN 4 131928495 missense probably damaging 1.00
IGL03388:Epb41 APN 4 131974794 missense probably damaging 1.00
R0355:Epb41 UTSW 4 132000261 missense probably damaging 0.99
R0532:Epb41 UTSW 4 131978795 splice site probably benign
R0550:Epb41 UTSW 4 131975613 missense probably damaging 1.00
R0571:Epb41 UTSW 4 131989904 missense probably damaging 1.00
R1158:Epb41 UTSW 4 132000191 splice site probably benign
R1444:Epb41 UTSW 4 132006071 missense probably benign
R2106:Epb41 UTSW 4 131989841 missense probably damaging 1.00
R2269:Epb41 UTSW 4 131964147 missense probably benign 0.09
R4014:Epb41 UTSW 4 131982445 splice site probably benign
R4017:Epb41 UTSW 4 131982445 splice site probably benign
R4952:Epb41 UTSW 4 132000270 missense probably damaging 0.99
R4976:Epb41 UTSW 4 131937436 unclassified probably benign
R5058:Epb41 UTSW 4 132007435 utr 5 prime probably benign
R5119:Epb41 UTSW 4 131937436 unclassified probably benign
R5229:Epb41 UTSW 4 131978935 missense probably damaging 1.00
R5571:Epb41 UTSW 4 131937406 unclassified probably benign
R6250:Epb41 UTSW 4 131989873 missense probably damaging 1.00
R6531:Epb41 UTSW 4 131957636 missense probably benign 0.00
R6890:Epb41 UTSW 4 131935829 missense probably damaging 0.98
R7265:Epb41 UTSW 4 131967834 missense unknown
R7289:Epb41 UTSW 4 131991209 critical splice donor site probably null
R7322:Epb41 UTSW 4 131989719 missense probably damaging 0.99
R7823:Epb41 UTSW 4 131974682 critical splice donor site probably null
R8296:Epb41 UTSW 4 131937461 missense
R8401:Epb41 UTSW 4 131974707 missense probably damaging 1.00
X0066:Epb41 UTSW 4 131974740 missense probably damaging 1.00
Z1177:Epb41 UTSW 4 132006083 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCGAGCTACCTAAATGATCAG -3'
(R):5'- GTTTTCTGCAGAGCCCACTC -3'

Sequencing Primer
(F):5'- CAGGAGTGTTTTATAGCAGCAACAC -3'
(R):5'- ACTCTGCTGGGTTGCCCTAG -3'
Posted On2020-07-28