Incidental Mutation 'R8317:1700007G11Rik'
ID 641737
Institutional Source Beutler Lab
Gene Symbol 1700007G11Rik
Ensembl Gene ENSMUSG00000057816
Gene Name RIKEN cDNA 1700007G11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock # R8317 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 98329304-98802047 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 98737600 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 122 (H122P)
Ref Sequence ENSEMBL: ENSMUSP00000079208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080333]
AlphaFold Q810M1
Predicted Effect probably benign
Transcript: ENSMUST00000080333
AA Change: H122P

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079208
Gene: ENSMUSG00000057816
AA Change: H122P

DomainStartEndE-ValueType
Pfam:DUF4464 12 232 7.1e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196339
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in 1700007G11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:1700007G11Rik APN 5 98784510 missense probably benign 0.00
IGL01133:1700007G11Rik APN 5 98498381 critical splice donor site probably null
IGL02151:1700007G11Rik APN 5 98329442 missense probably damaging 1.00
LCD18:1700007G11Rik UTSW 5 98707508 intron probably benign
PIT4514001:1700007G11Rik UTSW 5 98801871 missense probably benign 0.00
R0962:1700007G11Rik UTSW 5 98566561 intron probably benign
R1545:1700007G11Rik UTSW 5 98329432 missense probably benign 0.25
R1886:1700007G11Rik UTSW 5 98801831 missense probably benign 0.41
R1954:1700007G11Rik UTSW 5 98566753 intron probably benign
R1965:1700007G11Rik UTSW 5 98346234 missense probably damaging 1.00
R2008:1700007G11Rik UTSW 5 98737702 missense possibly damaging 0.90
R3873:1700007G11Rik UTSW 5 98737623 missense probably damaging 1.00
R4940:1700007G11Rik UTSW 5 98737636 missense possibly damaging 0.95
R5708:1700007G11Rik UTSW 5 98737707 missense probably benign
R6509:1700007G11Rik UTSW 5 98329397 missense probably benign 0.16
R6595:1700007G11Rik UTSW 5 98801858 missense possibly damaging 0.78
R7009:1700007G11Rik UTSW 5 98784520 missense probably damaging 0.99
R7911:1700007G11Rik UTSW 5 98737708 missense possibly damaging 0.58
R8211:1700007G11Rik UTSW 5 98329435 missense possibly damaging 0.77
R9058:1700007G11Rik UTSW 5 98784541 missense probably damaging 1.00
R9293:1700007G11Rik UTSW 5 98498303 missense probably benign 0.13
R9505:1700007G11Rik UTSW 5 98329354 start codon destroyed probably null 0.21
R9681:1700007G11Rik UTSW 5 98329355 start codon destroyed probably null 0.65
Z1177:1700007G11Rik UTSW 5 98801834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTACCTGAGATAATCATGGGTG -3'
(R):5'- AGTTATCCATTGCCAGCCTC -3'

Sequencing Primer
(F):5'- GTGAAACATACAGCAGCACTTG -3'
(R):5'- GGATTATGATACTGGTCTCAACATGC -3'
Posted On 2020-07-28