Incidental Mutation 'R8317:Skap2'
ID641739
Institutional Source Beutler Lab
Gene Symbol Skap2
Ensembl Gene ENSMUSG00000059182
Gene Namesrc family associated phosphoprotein 2
SynonymsSaps, RA70, SKAP-HOM, mSKAP55R, 2610021A10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location51857422-52012549 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 51907885 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078214] [ENSMUST00000203948] [ENSMUST00000204778]
Predicted Effect probably benign
Transcript: ENSMUST00000078214
SMART Domains Protein: ENSMUSP00000077342
Gene: ENSMUSG00000059182

DomainStartEndE-ValueType
PH 117 221 6.11e-18 SMART
low complexity region 254 269 N/A INTRINSIC
SH3 299 356 1.71e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203948
SMART Domains Protein: ENSMUSP00000145275
Gene: ENSMUSG00000059182

DomainStartEndE-ValueType
Blast:PH 1 49 1e-28 BLAST
PDB:1U5F|A 1 74 1e-30 PDB
SH3 83 126 3e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204778
SMART Domains Protein: ENSMUSP00000145462
Gene: ENSMUSG00000059182

DomainStartEndE-ValueType
PH 117 221 6.11e-18 SMART
low complexity region 254 269 N/A INTRINSIC
SH3 299 356 1.71e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares homology with Src kinase-associated phosphoprotein 1, and is a substrate of Src family kinases. It is an adaptor protein that is thought to play an essential role in the Src signaling pathway, and in regulating proper activation of the immune system. This protein contains an amino terminal coiled-coil domain for self-dimerization, a plecskstrin homology (PH) domain required for interactions with lipids at the membrane, and a Src homology (SH3) domain at the carboxy terminus. Some reports indicate that this protein inhibits actin polymerization through interactions with actin assembly factors, and might negatively regulate the invasiveness of tumors by modulating actin assembly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele are embryonic lethal. Homozygotes for a gene-trapped allele show impaired B-cell responses and B-cell adhesion, decreased susceptibility to EAE, abnormal dendritic cell physiology, fast extinction of fear memory, and impaired social memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Skap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Skap2 APN 6 51921300 missense probably damaging 1.00
IGL01526:Skap2 APN 6 51907914 missense probably benign 0.20
IGL01543:Skap2 APN 6 52012395 missense possibly damaging 0.88
IGL01879:Skap2 APN 6 51996034 missense possibly damaging 0.90
IGL01893:Skap2 APN 6 51874576 missense probably damaging 1.00
IGL02154:Skap2 APN 6 52012328 splice site probably benign
IGL02406:Skap2 APN 6 51874473 critical splice donor site probably null
IGL02409:Skap2 APN 6 51907958 missense possibly damaging 0.51
IGL02937:Skap2 APN 6 51909371 missense probably benign 0.01
R0648:Skap2 UTSW 6 51879785 missense probably benign 0.05
R1465:Skap2 UTSW 6 51909368 missense probably benign 0.00
R1465:Skap2 UTSW 6 51909368 missense probably benign 0.00
R2370:Skap2 UTSW 6 51921330 missense probably damaging 1.00
R3837:Skap2 UTSW 6 51909299 critical splice donor site probably null
R4847:Skap2 UTSW 6 52003669 missense probably benign 0.01
R4939:Skap2 UTSW 6 51922323 missense possibly damaging 0.49
R5555:Skap2 UTSW 6 51860018 missense probably damaging 1.00
R7703:Skap2 UTSW 6 51907954 missense probably benign 0.00
R8176:Skap2 UTSW 6 51907898 missense probably damaging 1.00
Z1176:Skap2 UTSW 6 51921280 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGATTGTCTCTGCTTCAC -3'
(R):5'- GCACGTAGATGACAGTTTTCAG -3'

Sequencing Primer
(F):5'- AGGATTGTCTCTGCTTCACTTTTAG -3'
(R):5'- CACGTAGATGACAGTTTTCAGAGTTG -3'
Posted On2020-07-28