Incidental Mutation 'R8317:Nod1'
ID641740
Institutional Source Beutler Lab
Gene Symbol Nod1
Ensembl Gene ENSMUSG00000038058
Gene Namenucleotide-binding oligomerization domain containing 1
SynonymsCard4, F830007N14Rik, Nlrc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location54923949-54972612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54943440 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 631 (Y631C)
Ref Sequence ENSEMBL: ENSMUSP00000055747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060655] [ENSMUST00000168172] [ENSMUST00000203076]
Predicted Effect probably damaging
Transcript: ENSMUST00000060655
AA Change: Y631C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055747
Gene: ENSMUSG00000038058
AA Change: Y631C

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:CARD 20 105 4.7e-21 PFAM
low complexity region 174 185 N/A INTRINSIC
Pfam:NACHT 196 368 1.3e-41 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 708 717 N/A INTRINSIC
LRR 727 754 1.25e0 SMART
LRR 755 782 1.22e1 SMART
LRR 783 810 1.96e2 SMART
LRR 811 838 1.08e-1 SMART
LRR 839 866 3.95e-4 SMART
LRR 867 894 1.51e0 SMART
LRR 895 922 7.15e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168172
AA Change: Y631C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130487
Gene: ENSMUSG00000038058
AA Change: Y631C

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:CARD 20 105 7.6e-20 PFAM
low complexity region 174 185 N/A INTRINSIC
Pfam:NACHT 196 368 6.2e-41 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 708 717 N/A INTRINSIC
LRR 727 754 1.25e0 SMART
LRR 755 782 1.22e1 SMART
LRR 783 810 1.96e2 SMART
LRR 811 838 1.08e-1 SMART
LRR 839 866 3.95e-4 SMART
LRR 867 894 1.51e0 SMART
LRR 895 922 7.15e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203076
AA Change: Y5C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145123
Gene: ENSMUSG00000038058
AA Change: Y5C

DomainStartEndE-ValueType
low complexity region 82 91 N/A INTRINSIC
LRR 101 128 5.3e-3 SMART
LRR 157 184 4.8e-4 SMART
LRR 185 212 1.7e-6 SMART
LRR 213 240 6.4e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOD (nucleotide-binding oligomerization domain) family. This member is a cytosolic protein. It contains an N-terminal caspase recruitment domain (CARD), a centrally located nucleotide-binding domain (NBD), and 10 tandem leucine-rich repeats (LRRs) in its C terminus. The CARD is involved in apoptotic signaling, LRRs participate in protein-protein interactions, and mutations in the NBD may affect the process of oligomerization and subsequent function of the LRR domain. This protein is an intracellular pattern-recognition receptor (PRR) that initiates inflammation in response to a subset of bacteria through the detection of bacterial diaminopimelic acid. Multiple alternatively spliced transcript variants differring in the 5' UTR have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice were viable, fertile, and appeared normal in a specific-pathogen free environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Nod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Nod1 APN 6 54944946 missense probably damaging 1.00
IGL00937:Nod1 APN 6 54937364 missense probably benign 0.08
IGL00945:Nod1 APN 6 54944586 splice site probably null
IGL01410:Nod1 APN 6 54944356 missense probably damaging 1.00
IGL02094:Nod1 APN 6 54939390 splice site probably null
IGL02217:Nod1 APN 6 54943419 missense possibly damaging 0.63
IGL02573:Nod1 APN 6 54943945 missense probably benign 0.02
IGL02944:Nod1 APN 6 54924947 missense possibly damaging 0.68
R0092:Nod1 UTSW 6 54944541 missense probably damaging 1.00
R0108:Nod1 UTSW 6 54943749 missense probably benign 0.27
R0148:Nod1 UTSW 6 54938217 missense probably damaging 1.00
R0771:Nod1 UTSW 6 54944269 missense probably damaging 0.96
R1493:Nod1 UTSW 6 54944056 missense probably damaging 1.00
R1540:Nod1 UTSW 6 54943975 missense probably benign 0.09
R1660:Nod1 UTSW 6 54944233 splice site probably null
R1710:Nod1 UTSW 6 54944059 missense probably damaging 0.98
R1911:Nod1 UTSW 6 54944440 missense probably damaging 0.96
R2008:Nod1 UTSW 6 54939325 missense probably damaging 1.00
R3409:Nod1 UTSW 6 54944917 missense probably benign 0.01
R3410:Nod1 UTSW 6 54944917 missense probably benign 0.01
R3927:Nod1 UTSW 6 54944917 missense probably benign 0.01
R4499:Nod1 UTSW 6 54943996 missense probably damaging 1.00
R4608:Nod1 UTSW 6 54943756 missense probably damaging 1.00
R5552:Nod1 UTSW 6 54944631 missense probably damaging 1.00
R5667:Nod1 UTSW 6 54933576 missense probably benign 0.06
R5859:Nod1 UTSW 6 54930177 missense probably benign 0.08
R5868:Nod1 UTSW 6 54939327 missense probably damaging 1.00
R5995:Nod1 UTSW 6 54944554 missense probably damaging 0.99
R6329:Nod1 UTSW 6 54944704 missense probably benign 0.00
R6331:Nod1 UTSW 6 54924983 missense probably damaging 1.00
R6642:Nod1 UTSW 6 54948029 missense probably damaging 1.00
R6798:Nod1 UTSW 6 54944611 missense probably damaging 0.97
R6889:Nod1 UTSW 6 54944109 missense probably benign 0.27
R7582:Nod1 UTSW 6 54944307 missense probably damaging 1.00
R8123:Nod1 UTSW 6 54937406 missense probably damaging 1.00
R8338:Nod1 UTSW 6 54943971 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTTGCAAAAGGCCAGCTTG -3'
(R):5'- AACAAGCTCGTCCTGCCATTC -3'

Sequencing Primer
(F):5'- AAGGCCAGCTTGAGGTAGTCC -3'
(R):5'- CTTCTCCTTCCAGTGCCTG -3'
Posted On2020-07-28