Incidental Mutation 'R8317:P3h3'
ID641743
Institutional Source Beutler Lab
Gene Symbol P3h3
Ensembl Gene ENSMUSG00000023191
Gene Nameprolyl 3-hydroxylase 3
SynonymsGrcb, Leprel2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124841089-124857752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124855153 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 257 (G257R)
Ref Sequence ENSEMBL: ENSMUSP00000116338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000046893] [ENSMUST00000135127] [ENSMUST00000204667]
Predicted Effect probably damaging
Transcript: ENSMUST00000023958
AA Change: G257R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191
AA Change: G257R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046893
SMART Domains Protein: ENSMUSP00000038536
Gene: ENSMUSG00000038390

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129225
Predicted Effect probably damaging
Transcript: ENSMUST00000135127
AA Change: G257R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191
AA Change: G257R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204161
Predicted Effect probably benign
Transcript: ENSMUST00000204667
SMART Domains Protein: ENSMUSP00000145267
Gene: ENSMUSG00000038390

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Meta Mutation Damage Score 0.1985 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the leprecan family of proteoglycans, which function as collagen prolyl hydroxylases that are required for proper collagen biosynthesis, folding and assembly. This protein, like other family members, is thought to reside in the endoplasmic reticulum. Epigenetic inactivation of this gene is associated with breast and other cancers, suggesting that it may function as a tumor suppressor. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit collagen fiber fragility in the skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in P3h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:P3h3 APN 6 124845589 missense probably benign 0.26
IGL02158:P3h3 APN 6 124853092 missense probably damaging 1.00
IGL02654:P3h3 APN 6 124845265 missense possibly damaging 0.95
P0040:P3h3 UTSW 6 124853136 missense probably damaging 0.99
R0024:P3h3 UTSW 6 124857458 missense probably benign
R0196:P3h3 UTSW 6 124845272 missense probably damaging 1.00
R0328:P3h3 UTSW 6 124854306 unclassified probably benign
R0589:P3h3 UTSW 6 124841681 missense probably damaging 1.00
R0605:P3h3 UTSW 6 124856035 missense probably damaging 1.00
R0793:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0794:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0795:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0796:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0853:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0854:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0856:P3h3 UTSW 6 124854933 missense probably benign 0.00
R0893:P3h3 UTSW 6 124845513 missense probably damaging 1.00
R1819:P3h3 UTSW 6 124854932 missense probably benign 0.05
R2100:P3h3 UTSW 6 124845042 missense probably damaging 1.00
R4332:P3h3 UTSW 6 124842136 missense probably damaging 1.00
R4461:P3h3 UTSW 6 124845568 missense probably benign 0.08
R4533:P3h3 UTSW 6 124854408 missense possibly damaging 0.62
R4829:P3h3 UTSW 6 124841638 utr 3 prime probably benign
R4840:P3h3 UTSW 6 124850637 missense possibly damaging 0.82
R4962:P3h3 UTSW 6 124841773 missense probably benign 0.09
R5014:P3h3 UTSW 6 124855236 missense probably damaging 1.00
R5591:P3h3 UTSW 6 124854695 unclassified probably benign
R5691:P3h3 UTSW 6 124855153 missense probably damaging 1.00
R5777:P3h3 UTSW 6 124855958 missense probably benign 0.24
R5846:P3h3 UTSW 6 124857194 critical splice donor site probably null
R6212:P3h3 UTSW 6 124845643 missense probably benign 0.19
R6254:P3h3 UTSW 6 124845601 missense probably damaging 1.00
R6320:P3h3 UTSW 6 124854872 missense probably benign 0.02
R6860:P3h3 UTSW 6 124857368 missense probably benign 0.01
R7385:P3h3 UTSW 6 124855270 missense probably damaging 1.00
R7472:P3h3 UTSW 6 124850631 missense possibly damaging 0.92
R7617:P3h3 UTSW 6 124856006 missense probably damaging 1.00
R7763:P3h3 UTSW 6 124854432 missense probably benign 0.00
R7831:P3h3 UTSW 6 124855155 missense possibly damaging 0.86
R8436:P3h3 UTSW 6 124851078 critical splice donor site probably null
X0021:P3h3 UTSW 6 124856029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGACAGGGAAGCTGCGA -3'
(R):5'- CCACCACCACTAATCTCTGG -3'

Sequencing Primer
(F):5'- GTATCCAGTGTCCTGCAGAGAAC -3'
(R):5'- ACCACTAATCTCTGGTGACTAGGTG -3'
Posted On2020-07-28