Mutagenetix > Incidental Mutation

Incidental Mutation 'R8317:Il16'

641745

Institutional Source

Beutler Lab

Gene Symbol

Il16

Ensembl Gene

ENSMUSG00000001741

Gene Name

interleukin 16

Synonyms

MMRRC Submission

067721-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.264) question?

Stock #

R8317 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83642825-83745726 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83655330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 665 (T665A)

Ref Sequence

ENSEMBL: ENSMUSP00000001792 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000117410] [ENSMUST00000145610]

AlphaFold

O54824

Predicted Effect

probably benign
Transcript: ENSMUST00000001792
AA Change: T665A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: T665A

Domain	Start	End	E-Value	Type
low complexity region	76	92	N/A	INTRINSIC
low complexity region	99	115	N/A	INTRINSIC
PDZ	222	300	6.5e-23	SMART
PDZ	361	438	3.89e-12	SMART
low complexity region	507	526	N/A	INTRINSIC
low complexity region	556	577	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	647	680	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	825	839	N/A	INTRINSIC
low complexity region	978	989	N/A	INTRINSIC
PDZ	1115	1192	3.6e-16	SMART
low complexity region	1201	1216	N/A	INTRINSIC
PDZ	1234	1310	4.11e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117410

SMART Domains

Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027

Domain	Start	End	E-Value	Type
Pfam:START	7	196	5.9e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145610

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	C	5: 98,737,600	H122P	probably benign	Het
1700029P11Rik	A	G	15: 81,980,777	Y73C	probably damaging	Het
Adgrv1	C	T	13: 81,575,117	V621M	probably damaging	Het
Adipor1	C	T	1: 134,428,167	R235W	probably benign	Het
Agbl1	T	A	7: 76,422,181	M594K	unknown	Het
Als2cr12	T	C	1: 58,676,548	K170E	possibly damaging	Het
Ang2	A	G	14: 51,195,892	V11A	probably benign	Het
BC027072	A	C	17: 71,749,202	L1160R	probably benign	Het
Ccl25	A	G	8: 4,354,138	N80S	probably benign	Het
Cd19	A	T	7: 126,413,443	C259*	probably null	Het
Cd209b	A	T	8: 3,922,018	I177N	probably damaging	Het
Cdc20	C	A	4: 118,437,126		probably benign	Het
Cdh23	A	T	10: 60,311,258		probably null	Het
Cdh23	G	A	10: 60,436,789	R536W	probably damaging	Het
Chd6	T	C	2: 160,990,321	D977G	probably damaging	Het
Csl	T	G	10: 99,759,038	H55P	probably damaging	Het
Cstf2t	G	A	19: 31,084,248	A395T	probably benign	Het
Dhx58	A	T	11: 100,703,562	I101N	probably damaging	Het
Dlg5	A	C	14: 24,191,230	S200A	probably damaging	Het
Epb41	C	A	4: 131,957,650	G86V		Het
Fat4	T	C	3: 38,958,510	V2318A	possibly damaging	Het
Fbxo32	A	T	15: 58,205,230	F119I	probably damaging	Het
Fndc1	A	T	17: 7,800,888	L153*	probably null	Het
Foxp1	TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	6: 99,075,905		probably benign	Het
Gm4559	CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT	CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT	7: 142,273,816		probably benign	Het
Gpr63	A	T	4: 25,008,223	T316S	probably damaging	Het
Ick	T	A	9: 78,153,651	V193E	probably damaging	Het
Lama5	T	C	2: 180,206,991	N272S	probably damaging	Het
Map3k1	T	C	13: 111,758,162	Y660C	probably damaging	Het
Mbd3l1	C	A	9: 18,484,821	L81I	probably benign	Het
Morc3	C	A	16: 93,862,529	Q442K	probably benign	Het
Muc16	G	A	9: 18,658,043	T1060I	unknown	Het
Myh11	T	A	16: 14,208,077	D1343V		Het
Myh15	C	A	16: 49,120,018	T777N	probably damaging	Het
Nbn	T	G	4: 15,970,893	L292W	probably damaging	Het
Nebl	A	G	2: 17,350,757	M195T	possibly damaging	Het
Net1	T	C	13: 3,907,856	K66E	possibly damaging	Het
Nod1	T	C	6: 54,943,440	Y631C	probably damaging	Het
Nxf1	A	G	19: 8,771,043	H12R	probably benign	Het
Onecut3	T	C	10: 80,495,327	L107P	unknown	Het
Opa1	T	G	16: 29,614,144	I512S	probably damaging	Het
P3h3	C	T	6: 124,855,153	G257R	probably damaging	Het
Pappa2	A	G	1: 158,764,960	C1616R	probably damaging	Het
Parn	T	G	16: 13,541,100	K593Q	probably damaging	Het
Polr3g	T	C	13: 81,678,183	K173R	unknown	Het
Prcp	A	G	7: 92,875,390	T18A	probably benign	Het
Sash1	G	A	10: 8,729,386	T1080M	possibly damaging	Het
Skap2	A	G	6: 51,907,885		probably null	Het
Srebf1	C	A	11: 60,200,657	S1014I	possibly damaging	Het
Stk32b	C	T	5: 37,454,975	E356K	probably damaging	Het
Tex37	C	A	6: 70,913,292	W172L	possibly damaging	Het
Tjp3	T	A	10: 81,280,490	T257S	probably benign	Het
Trf	A	G	9: 103,217,516	Y448H	probably damaging	Het
Tsnaxip1	G	C	8: 105,827,806	R7P	probably benign	Het
Vmn1r208	G	C	13: 22,772,777	I183M	probably benign	Het
Vmn2r67	T	A	7: 85,136,626	M724L	probably benign	Het
Wdhd1	A	T	14: 47,263,537	H469Q	probably damaging	Het
Zbtb7a	G	C	10: 81,144,950	G326A	probably benign	Het
Zfp493	G	A	13: 67,783,839	R19H	probably benign	Het
Zfp932	A	T	5: 110,009,056	K207*	probably null	Het

Other mutations in Il16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Il16	APN	7	83652458	missense	probably benign	0.02
IGL01743:Il16	APN	7	83652299	missense	probably benign	0.00
IGL01770:Il16	APN	7	83673026	splice site	probably benign
IGL02025:Il16	APN	7	83652848	missense	probably damaging	1.00
IGL02317:Il16	APN	7	83666889	missense	probably damaging	1.00
IGL02412:Il16	APN	7	83652691	missense	probably benign	0.03
IGL02550:Il16	APN	7	83674496	missense	possibly damaging	0.90
IGL02568:Il16	APN	7	83661276	missense	probably damaging	1.00
IGL02578:Il16	APN	7	83677986	critical splice donor site	probably null
IGL02815:Il16	APN	7	83651041	missense	probably damaging	0.98
IGL03157:Il16	APN	7	83722403	missense	probably damaging	1.00
IGL03161:Il16	APN	7	83722499	missense	probably damaging	1.00
IGL03188:Il16	APN	7	83688163	missense	probably benign	0.00
IGL03213:Il16	APN	7	83646500	missense	probably damaging	1.00
IGL03274:Il16	APN	7	83661234	missense	probably damaging	1.00
R0201:Il16	UTSW	7	83722308	missense	probably damaging	0.99
R0309:Il16	UTSW	7	83722554	missense	probably damaging	1.00
R0597:Il16	UTSW	7	83677975	splice site	probably benign
R0942:Il16	UTSW	7	83663141	missense	probably benign	0.01
R1018:Il16	UTSW	7	83674538	missense	probably damaging	1.00
R1434:Il16	UTSW	7	83655312	missense	probably benign
R1715:Il16	UTSW	7	83648728	missense	probably benign	0.01
R2179:Il16	UTSW	7	83688079	splice site	probably null
R2520:Il16	UTSW	7	83651994	missense	probably benign	0.03
R3425:Il16	UTSW	7	83644040	missense	probably damaging	1.00
R3761:Il16	UTSW	7	83650885	missense	possibly damaging	0.96
R3943:Il16	UTSW	7	83652015	missense	probably damaging	0.97
R4470:Il16	UTSW	7	83650838	intron	probably benign
R4530:Il16	UTSW	7	83681310	intron	probably benign
R4583:Il16	UTSW	7	83682899	missense	probably damaging	1.00
R4777:Il16	UTSW	7	83650896	missense	probably benign	0.14
R4874:Il16	UTSW	7	83660945	missense	possibly damaging	0.56
R4876:Il16	UTSW	7	83673094	missense	probably benign
R5677:Il16	UTSW	7	83674553	missense	probably damaging	1.00
R5686:Il16	UTSW	7	83648728	missense	probably benign	0.36
R5920:Il16	UTSW	7	83652344	missense	probably benign	0.03
R6115:Il16	UTSW	7	83652567	nonsense	probably null
R6459:Il16	UTSW	7	83722321	missense	probably damaging	1.00
R6459:Il16	UTSW	7	83722328	missense	probably damaging	1.00
R6601:Il16	UTSW	7	83722469	missense	probably damaging	1.00
R6616:Il16	UTSW	7	83646476	missense	probably benign	0.37
R6642:Il16	UTSW	7	83688127	missense	probably benign	0.03
R6721:Il16	UTSW	7	83663062	critical splice donor site	probably null
R7009:Il16	UTSW	7	83646388	missense	probably benign
R7144:Il16	UTSW	7	83646451	missense	probably damaging	0.97
R7346:Il16	UTSW	7	83644041	missense	probably damaging	1.00
R7403:Il16	UTSW	7	83670135	missense	probably damaging	1.00
R7499:Il16	UTSW	7	83674494	missense	probably damaging	0.99
R7814:Il16	UTSW	7	83670140	missense	possibly damaging	0.46
R7941:Il16	UTSW	7	83682829	missense	probably damaging	0.98
R8098:Il16	UTSW	7	83646559	missense	probably damaging	1.00
R8437:Il16	UTSW	7	83652143	missense	probably damaging	1.00
R9094:Il16	UTSW	7	83652351	missense	probably benign
R9267:Il16	UTSW	7	83722549	missense	probably benign	0.01
R9445:Il16	UTSW	7	83688172	nonsense	probably null
R9595:Il16	UTSW	7	83673065	nonsense	probably null
R9651:Il16	UTSW	7	83682856	missense	probably damaging	0.96
Z1176:Il16	UTSW	7	83652827	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGTGTCCACTGTGTCCATG -3'
(R):5'- AAGAGACCCCTTTCTCATGACTG -3'

Sequencing Primer
(F):5'- TGTGTCCATGCAAAACACTG -3'
(R):5'- GAATTTCCCGCTAAAGGTGTC -3'

Posted On

2020-07-28