Incidental Mutation 'R8317:Prcp'
ID641747
Institutional Source Beutler Lab
Gene Symbol Prcp
Ensembl Gene ENSMUSG00000061119
Gene Nameprolylcarboxypeptidase (angiotensinase C)
Synonyms2510048K03Rik, 2610104A14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location92874470-92934583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92875390 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 18 (T18A)
Ref Sequence ENSEMBL: ENSMUSP00000075429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032877] [ENSMUST00000076052] [ENSMUST00000207594] [ENSMUST00000208356] [ENSMUST00000209074]
Predicted Effect probably benign
Transcript: ENSMUST00000032877
SMART Domains Protein: ENSMUSP00000032877
Gene: ENSMUSG00000030641

DomainStartEndE-ValueType
Pfam:Rep_fac-A_C 7 118 2.1e-14 PFAM
low complexity region 197 209 N/A INTRINSIC
low complexity region 242 253 N/A INTRINSIC
low complexity region 727 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076052
AA Change: T18A

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075429
Gene: ENSMUSG00000061119
AA Change: T18A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Peptidase_S37 20 211 1.4e-4 PFAM
Pfam:Peptidase_S28 53 475 3.4e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207594
AA Change: T18A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000208356
Predicted Effect probably benign
Transcript: ENSMUST00000209074
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S28 family of serine exopeptidases. The encoded preproprotein is proteolytically processed to generate the mature lysosomal prolylcarboxypeptidase. This enzyme cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity is retained with some substrates at neutral pH. This enzyme has been shown to be an activator of the cell matrix-associated prekallikrein. The importance of angiotension II, one of the substrates of this enzyme, in regulating blood pressure and electrolyte balance suggests that this gene may be related to essential hypertension. A pseudogene of this gene has been identified on chromosome 2. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased body length, weight, and fat pads with resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Prcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Prcp APN 7 92933099 missense probably benign 0.00
IGL01124:Prcp APN 7 92910208 missense probably benign 0.01
IGL01538:Prcp APN 7 92910213 missense probably benign 0.09
IGL02005:Prcp APN 7 92927824 missense probably benign 0.01
IGL02160:Prcp APN 7 92917761 missense probably benign 0.02
IGL02548:Prcp APN 7 92901174 missense probably damaging 0.98
R0140:Prcp UTSW 7 92928611 missense probably damaging 1.00
R0480:Prcp UTSW 7 92919082 missense probably damaging 1.00
R0989:Prcp UTSW 7 92910216 missense probably benign 0.04
R1216:Prcp UTSW 7 92917746 missense probably benign
R1596:Prcp UTSW 7 92917834 intron probably benign
R1823:Prcp UTSW 7 92928675 missense probably damaging 0.98
R2132:Prcp UTSW 7 92901280 missense probably benign 0.01
R2206:Prcp UTSW 7 92928612 missense probably damaging 1.00
R4761:Prcp UTSW 7 92917725 splice site probably null
R5000:Prcp UTSW 7 92919160 missense probably damaging 0.99
R5320:Prcp UTSW 7 92928635 missense probably benign 0.01
R5969:Prcp UTSW 7 92917766 missense probably benign 0.01
R6013:Prcp UTSW 7 92927768 missense possibly damaging 0.72
R6298:Prcp UTSW 7 92928633 missense probably damaging 1.00
R7733:Prcp UTSW 7 92901298 missense probably damaging 1.00
R7852:Prcp UTSW 7 92928692 missense probably benign 0.33
R8032:Prcp UTSW 7 92928698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTGTGACCTCAGTGGAG -3'
(R):5'- CAACAGCCAAGCAAGGTATG -3'

Sequencing Primer
(F):5'- CTTTGGGGCCAGGAGCTG -3'
(R):5'- CCAAGCAAGGTATGGGCGG -3'
Posted On2020-07-28