Incidental Mutation 'R8317:Cd19'
ID641748
Institutional Source Beutler Lab
Gene Symbol Cd19
Ensembl Gene ENSMUSG00000030724
Gene NameCD19 antigen
SynonymsAW495831
MMRRC Submission
Accession Numbers

Ncbi Ref Seq: NM_009844.2; MGI: 88319

Is this an essential gene? Possibly essential (E-score: 0.740) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location126408450-126414889 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 126413443 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 259 (C259*)
Ref Sequence ENSEMBL: ENSMUSP00000145803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032968] [ENSMUST00000206325]
Predicted Effect probably null
Transcript: ENSMUST00000032968
AA Change: C259*
SMART Domains Protein: ENSMUSP00000032968
Gene: ENSMUSG00000030724
AA Change: C259*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 23 116 9.12e-7 SMART
low complexity region 139 150 N/A INTRINSIC
IG 182 273 2.41e-6 SMART
transmembrane domain 288 310 N/A INTRINSIC
low complexity region 390 415 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000206325
AA Change: C259*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lymphocytes proliferate and differentiate in response to various concentrations of different antigens. The ability of the B cell to respond in a specific, yet sensitive manner to the various antigens is achieved with the use of low-affinity antigen receptors. This gene encodes a cell surface molecule which assembles with the antigen receptor of B lymphocytes in order to decrease the threshold for antigen receptor-dependent stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal B lymphocyte development, activation and differentiation, altered mast cell activation in a model for acute septic peritonitis, inhibition of bleomycin-induced fibrosis and autoantibody production, and increased susceptibility to EAE. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Cd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01896:Cd19 APN 7 126414350 missense possibly damaging 0.74
IGL02243:Cd19 APN 7 126410793 splice site probably null
IGL02465:Cd19 APN 7 126413558 missense possibly damaging 0.65
IGL02824:Cd19 APN 7 126410654 missense probably damaging 0.96
IGL03164:Cd19 APN 7 126413509 missense possibly damaging 0.95
Hexagonal UTSW 7 126414306 nonsense probably null
hive UTSW 7 126412109 missense probably damaging 1.00
R0076:Cd19 UTSW 7 126410862 missense probably damaging 1.00
R0076:Cd19 UTSW 7 126410862 missense probably damaging 1.00
R1147:Cd19 UTSW 7 126411045 missense possibly damaging 0.60
R1147:Cd19 UTSW 7 126411045 missense possibly damaging 0.60
R1860:Cd19 UTSW 7 126409641 missense probably damaging 1.00
R2309:Cd19 UTSW 7 126414275 missense probably benign 0.01
R4422:Cd19 UTSW 7 126413406 missense probably benign 0.31
R4532:Cd19 UTSW 7 126412109 missense probably damaging 1.00
R4649:Cd19 UTSW 7 126414492 missense probably benign 0.00
R5400:Cd19 UTSW 7 126414452 missense probably benign 0.34
R6846:Cd19 UTSW 7 126410853 missense probably benign 0.28
R7027:Cd19 UTSW 7 126410499 missense possibly damaging 0.72
R7226:Cd19 UTSW 7 126414823 missense unknown
R7464:Cd19 UTSW 7 126411803 missense probably damaging 1.00
R7612:Cd19 UTSW 7 126414324 missense possibly damaging 0.87
R7797:Cd19 UTSW 7 126413508 missense probably damaging 1.00
R7869:Cd19 UTSW 7 126410526 missense probably damaging 1.00
R7885:Cd19 UTSW 7 126412131 missense probably benign 0.03
R8151:Cd19 UTSW 7 126414306 nonsense probably null
R8438:Cd19 UTSW 7 126414343 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTGGAGTTAGGATTCAGTGAACAAAC -3'
(R):5'- CACACTTTGGCTGTCCTGTG -3'

Sequencing Primer
(F):5'- TCTCTACACACAGAGACTTCTAGGGG -3'
(R):5'- TACCCCCTGTCCCAGTGG -3'
Posted On2020-07-28