Incidental Mutation 'R8317:Cd209b'
ID641750
Institutional Source Beutler Lab
Gene Symbol Cd209b
Ensembl Gene ENSMUSG00000065987
Gene NameCD209b antigen
Synonyms1810030I22Rik, SIGNR1, mSIGNR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location3917655-3926844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3922018 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 177 (I177N)
Ref Sequence ENSEMBL: ENSMUSP00000081104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084086] [ENSMUST00000111014] [ENSMUST00000171635] [ENSMUST00000188386]
PDB Structure
Crystallographic structure of the native mouse SIGN-R1 CRD domain [X-RAY DIFFRACTION]
Structure of SIGN-R1 in complex with Sulfodextran [X-RAY DIFFRACTION]
Crystallographic structure of the mouse SIGN-R1 CRD domain in complex with sialic acid [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000084086
AA Change: I177N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081104
Gene: ENSMUSG00000065987
AA Change: I177N

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
low complexity region 91 102 N/A INTRINSIC
CLECT 195 316 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111014
AA Change: I177N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106643
Gene: ENSMUSG00000065987
AA Change: I177N

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171635
AA Change: I147N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126070
Gene: ENSMUSG00000065987
AA Change: I147N

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 286 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188386
AA Change: I147N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140695
Gene: ENSMUSG00000065987
AA Change: I147N

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants are more susceptible to S. pneumoniae infection and fail to clear the bacteria from the circulation. Marginal zone and peritoneal macrophages are impaired in recognizing the bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Cd209b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Cd209b APN 8 3919945 splice site probably benign
IGL01596:Cd209b APN 8 3918744 missense probably damaging 1.00
IGL03211:Cd209b APN 8 3918830 splice site probably benign
R1434:Cd209b UTSW 8 3923367 missense possibly damaging 0.49
R4127:Cd209b UTSW 8 3918714 missense probably damaging 1.00
R4387:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4388:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4389:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4708:Cd209b UTSW 8 3924215 missense probably damaging 0.99
R4710:Cd209b UTSW 8 3924215 missense probably damaging 0.99
R4911:Cd209b UTSW 8 3926640 critical splice acceptor site probably null
R5454:Cd209b UTSW 8 3925396 missense probably damaging 0.98
R5814:Cd209b UTSW 8 3923348 missense probably damaging 0.99
R5853:Cd209b UTSW 8 3926549 splice site probably null
R5867:Cd209b UTSW 8 3924246 missense possibly damaging 0.62
R5996:Cd209b UTSW 8 3918688 missense probably benign 0.39
R7020:Cd209b UTSW 8 3918783 missense probably damaging 0.99
R7187:Cd209b UTSW 8 3926638 missense probably benign
R7695:Cd209b UTSW 8 3926005 missense probably benign
R7712:Cd209b UTSW 8 3923299 missense possibly damaging 0.83
R7975:Cd209b UTSW 8 3925948 missense probably benign 0.41
R8309:Cd209b UTSW 8 3926559 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCCCCTGTTAATATTGAGTGC -3'
(R):5'- GAGTTTGAGATGTTCCGACAAC -3'

Sequencing Primer
(F):5'- CCCTGTTAATATTGAGTGCCTGCTG -3'
(R):5'- AACAGGGTGAGCTCCATCTC -3'
Posted On2020-07-28