Incidental Mutation 'R8317:Ccl25'
ID641751
Institutional Source Beutler Lab
Gene Symbol Ccl25
Ensembl Gene ENSMUSG00000023235
Gene Namechemokine (C-C motif) ligand 25
SynonymsCKb15, Scya25, TECK
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location4325210-4360020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4354138 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 80 (N80S)
Ref Sequence ENSEMBL: ENSMUSP00000106610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024004] [ENSMUST00000110982] [ENSMUST00000127460] [ENSMUST00000136191] [ENSMUST00000155797]
Predicted Effect probably benign
Transcript: ENSMUST00000024004
AA Change: N80S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000024004
Gene: ENSMUSG00000023235
AA Change: N80S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCY 27 88 1.34e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110982
AA Change: N80S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000106610
Gene: ENSMUSG00000023235
AA Change: N80S

DomainStartEndE-ValueType
SCY 27 88 1.34e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127460
AA Change: N164S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120719
Gene: ENSMUSG00000023235
AA Change: N164S

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
SCY 111 172 1.34e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136191
SMART Domains Protein: ENSMUSP00000117515
Gene: ENSMUSG00000023235

DomainStartEndE-ValueType
Pfam:IL8 23 66 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155797
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired accumulation of antigen-specific CD8+ T lymphocytes within both lamina propria and epithelium of the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Ccl25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Ccl25 APN 8 4348700 intron probably benign
IGL02188:Ccl25 APN 8 4348552 intron probably benign
IGL03338:Ccl25 APN 8 4349898 intron probably benign
R0584:Ccl25 UTSW 8 4354085 splice site probably benign
R0613:Ccl25 UTSW 8 4349850 missense probably benign 0.42
R1208:Ccl25 UTSW 8 4357631 missense possibly damaging 0.92
R1208:Ccl25 UTSW 8 4357631 missense possibly damaging 0.92
R1413:Ccl25 UTSW 8 4353892 makesense probably null
R3844:Ccl25 UTSW 8 4354183 missense possibly damaging 0.86
R4279:Ccl25 UTSW 8 4349829 missense probably damaging 1.00
R4921:Ccl25 UTSW 8 4353913 missense possibly damaging 0.92
R7021:Ccl25 UTSW 8 4349641 intron probably benign
R7033:Ccl25 UTSW 8 4349641 intron probably benign
R7630:Ccl25 UTSW 8 4353955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGAATGTTCTCCGGCATG -3'
(R):5'- ACACTTACCCAGAATGCTGAAGG -3'

Sequencing Primer
(F):5'- TCCGGCATGCTAGGAATTATCAC -3'
(R):5'- TGCTGAAGGACTCAATGCAC -3'
Posted On2020-07-28