Incidental Mutation 'R8317:Zbtb7a'
ID641761
Institutional Source Beutler Lab
Gene Symbol Zbtb7a
Ensembl Gene ENSMUSG00000035011
Gene Namezinc finger and BTB domain containing 7a
SynonymsLeukemia/lymphoma Related Factor, 9030619K07Rik, 9130006G12Rik, FBI-1, Pokemon, Lrf, Zbtb7
MMRRC Submission
Accession Numbers

Genbank: NM_010731; MGI: 1335091

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location81135220-81152995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 81144950 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 326 (G326A)
Ref Sequence ENSEMBL: ENSMUSP00000047333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048128] [ENSMUST00000117956] [ENSMUST00000119606] [ENSMUST00000121840] [ENSMUST00000125261] [ENSMUST00000146895]
Predicted Effect probably benign
Transcript: ENSMUST00000048128
AA Change: G326A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047333
Gene: ENSMUSG00000035011
AA Change: G326A

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117956
AA Change: G326A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113428
Gene: ENSMUSG00000035011
AA Change: G326A

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119606
AA Change: G326A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113612
Gene: ENSMUSG00000035011
AA Change: G326A

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121840
AA Change: G326A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113787
Gene: ENSMUSG00000035011
AA Change: G326A

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125261
SMART Domains Protein: ENSMUSP00000114470
Gene: ENSMUSG00000035011

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146895
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die around E16.5 due to anemia and exhibit a cell autonomous defect in early B cell development. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(54)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Zbtb7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02937:Zbtb7a APN 10 81144298 missense probably benign 0.30
Bushel UTSW 10 81148329 missense probably benign 0.01
dram UTSW 10 81144266 missense probably damaging 1.00
Gallon UTSW 10 81144440 missense probably damaging 1.00
peck UTSW 10 81143986 missense probably damaging 1.00
D6062:Zbtb7a UTSW 10 81144358 missense probably damaging 0.99
R0529:Zbtb7a UTSW 10 81143986 missense probably damaging 1.00
R0562:Zbtb7a UTSW 10 81148329 missense probably benign 0.01
R2045:Zbtb7a UTSW 10 81144410 missense probably benign 0.03
R2275:Zbtb7a UTSW 10 81144997 missense possibly damaging 0.95
R3755:Zbtb7a UTSW 10 81144266 missense probably damaging 1.00
R3883:Zbtb7a UTSW 10 81148025 missense probably damaging 1.00
R4723:Zbtb7a UTSW 10 81144440 missense probably damaging 1.00
R5503:Zbtb7a UTSW 10 81144797 missense probably damaging 0.96
R5650:Zbtb7a UTSW 10 81145049 missense probably damaging 1.00
R6872:Zbtb7a UTSW 10 81148071 missense possibly damaging 0.95
R7196:Zbtb7a UTSW 10 81144600 missense probably damaging 0.99
R7558:Zbtb7a UTSW 10 81148435 makesense probably null
R7602:Zbtb7a UTSW 10 81144176 missense probably damaging 0.99
R8220:Zbtb7a UTSW 10 81145004 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACAGAACGGCCACTATGG -3'
(R):5'- TACACTCGTAGGGCTTCTCG -3'

Sequencing Primer
(F):5'- ACTATGGCCGTGCAGGG -3'
(R):5'- CTGAATCACCTTCTCGCAGATGG -3'
Posted On2020-07-28