Incidental Mutation 'R8317:Net1'
ID641766
Institutional Source Beutler Lab
Gene Symbol Net1
Ensembl Gene ENSMUSG00000021215
Gene Nameneuroepithelial cell transforming gene 1
SynonymsmNET1, 0610025H04Rik, 9530071N24Rik, Net1 homolog
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location3882018-3918220 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3907856 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 66 (K66E)
Ref Sequence ENSEMBL: ENSMUSP00000089464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091853]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091853
AA Change: K66E

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089464
Gene: ENSMUSG00000021215
AA Change: K66E

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
RhoGEF 178 355 2.84e-54 SMART
PH 387 503 5.79e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of the family of Rho guanine nucleotide exchange factors. Members of this family activate Rho proteins by catalyzing the exchange of GDP for GTP. The protein encoded by this gene interacts with RhoA within the cell nucleus and may play a role in repairing DNA damage after ionizing radiation. Pseudogenes of this gene are located on the long arms of chromosomes 1, 7 and 18. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit delayed mammary gland development during puberty associated with slower ductal extension, reduced ductal branching and epithelial cell proliferation, disorganized myoepithelial and ductal epithelial cells, and increased collagen deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Net1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Net1 APN 13 3893391 utr 5 prime probably benign
IGL02271:Net1 APN 13 3887663 missense probably damaging 1.00
IGL02698:Net1 APN 13 3887569 critical splice donor site probably null
R0580:Net1 UTSW 13 3886612 missense probably damaging 1.00
R1028:Net1 UTSW 13 3884375 missense probably damaging 1.00
R1070:Net1 UTSW 13 3912930 missense probably benign 0.31
R1775:Net1 UTSW 13 3887642 missense probably damaging 1.00
R1834:Net1 UTSW 13 3912941 unclassified probably benign
R3968:Net1 UTSW 13 3907795 critical splice donor site probably null
R4056:Net1 UTSW 13 3884949 missense probably damaging 1.00
R4884:Net1 UTSW 13 3884252 nonsense probably null
R4937:Net1 UTSW 13 3884905 missense probably damaging 1.00
R5068:Net1 UTSW 13 3886740 missense probably benign 0.30
R5123:Net1 UTSW 13 3886623 missense probably damaging 0.97
R5389:Net1 UTSW 13 3886170 missense probably damaging 1.00
R5390:Net1 UTSW 13 3893379 missense probably benign 0.18
R5509:Net1 UTSW 13 3884320 missense probably benign 0.00
R6548:Net1 UTSW 13 3886074 splice site probably null
R7056:Net1 UTSW 13 3884845 missense probably benign 0.00
R7138:Net1 UTSW 13 3888510 missense probably damaging 1.00
R8375:Net1 UTSW 13 3893458 unclassified probably benign
RF006:Net1 UTSW 13 3887406 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACTCTGTAGCAATCCCGTTCAG -3'
(R):5'- CCAGAGACAATTTGGAATTTCCC -3'

Sequencing Primer
(F):5'- GTAGCAATCCCGTTCAGTTTTC -3'
(R):5'- CATATGCACCTGCGTGTGTACAG -3'
Posted On2020-07-28