Incidental Mutation 'R8317:Wdhd1'
ID641773
Institutional Source Beutler Lab
Gene Symbol Wdhd1
Ensembl Gene ENSMUSG00000037572
Gene NameWD repeat and HMG-box DNA binding protein 1
SynonymsAND-1, D630024B06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location47240944-47276857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47263537 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 469 (H469Q)
Ref Sequence ENSEMBL: ENSMUSP00000107420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111790] [ENSMUST00000111791] [ENSMUST00000111792] [ENSMUST00000187531]
Predicted Effect probably damaging
Transcript: ENSMUST00000111790
AA Change: H469Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107420
Gene: ENSMUSG00000037572
AA Change: H469Q

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:DUF3639 525 551 2.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111791
AA Change: H469Q
SMART Domains Protein: ENSMUSP00000107421
Gene: ENSMUSG00000037572
AA Change: H469Q

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:Mcl1_mid 424 708 1.6e-103 PFAM
coiled coil region 802 834 N/A INTRINSIC
HMG 1003 1073 2.64e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111792
AA Change: H432Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107422
Gene: ENSMUSG00000037572
AA Change: H432Q

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 316 326 N/A INTRINSIC
Pfam:DUF3639 488 514 7.1e-13 PFAM
coiled coil region 765 797 N/A INTRINSIC
HMG 966 1036 2.64e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187531
AA Change: H469Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141182
Gene: ENSMUSG00000037572
AA Change: H469Q

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:DUF3639 525 551 3e-13 PFAM
coiled coil region 802 834 N/A INTRINSIC
HMG 1003 1073 2.64e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains multiple N-terminal WD40 domains and a C-terminal high mobility group (HMG) box. WD40 domains are found in a variety of eukaryotic proteins and may function as adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Wdhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Wdhd1 APN 14 47250782 missense possibly damaging 0.87
IGL01789:Wdhd1 APN 14 47274817 missense probably benign 0.10
IGL01981:Wdhd1 APN 14 47261450 missense probably damaging 1.00
IGL02034:Wdhd1 APN 14 47261351 missense probably benign 0.02
IGL02932:Wdhd1 APN 14 47272134 critical splice donor site probably null
IGL02966:Wdhd1 APN 14 47241644 missense possibly damaging 0.93
IGL03355:Wdhd1 APN 14 47243889 missense possibly damaging 0.78
R0165:Wdhd1 UTSW 14 47267068 missense probably benign 0.00
R0414:Wdhd1 UTSW 14 47276588 missense probably benign
R0603:Wdhd1 UTSW 14 47263586 missense probably damaging 1.00
R1503:Wdhd1 UTSW 14 47247400 missense probably benign 0.00
R1539:Wdhd1 UTSW 14 47245050 missense possibly damaging 0.63
R1541:Wdhd1 UTSW 14 47268192 nonsense probably null
R1588:Wdhd1 UTSW 14 47256236 missense probably damaging 1.00
R1686:Wdhd1 UTSW 14 47256215 missense probably damaging 1.00
R1916:Wdhd1 UTSW 14 47258577 missense possibly damaging 0.89
R1952:Wdhd1 UTSW 14 47270190 missense probably damaging 1.00
R2320:Wdhd1 UTSW 14 47274028 missense probably benign 0.06
R2421:Wdhd1 UTSW 14 47258584 missense probably benign 0.00
R3731:Wdhd1 UTSW 14 47247892 missense possibly damaging 0.89
R3818:Wdhd1 UTSW 14 47243801 critical splice donor site probably null
R3836:Wdhd1 UTSW 14 47245054 missense probably benign 0.01
R4789:Wdhd1 UTSW 14 47268692 missense probably benign 0.01
R4963:Wdhd1 UTSW 14 47268689 missense possibly damaging 0.66
R4994:Wdhd1 UTSW 14 47268654 critical splice donor site probably null
R5225:Wdhd1 UTSW 14 47250816 missense probably benign 0.01
R5347:Wdhd1 UTSW 14 47268724 nonsense probably null
R5377:Wdhd1 UTSW 14 47272221 missense probably benign 0.15
R6038:Wdhd1 UTSW 14 47263580 missense possibly damaging 0.89
R6038:Wdhd1 UTSW 14 47263580 missense possibly damaging 0.89
R6046:Wdhd1 UTSW 14 47273210 nonsense probably null
R6156:Wdhd1 UTSW 14 47268196 missense probably damaging 0.99
R6289:Wdhd1 UTSW 14 47258496 missense possibly damaging 0.95
R6298:Wdhd1 UTSW 14 47273122 missense possibly damaging 0.67
R6345:Wdhd1 UTSW 14 47251922 missense probably damaging 0.99
R6405:Wdhd1 UTSW 14 47243867 missense possibly damaging 0.91
R6500:Wdhd1 UTSW 14 47250760 splice site probably null
R6564:Wdhd1 UTSW 14 47248042 missense probably benign
R6897:Wdhd1 UTSW 14 47248130 missense probably damaging 1.00
R7262:Wdhd1 UTSW 14 47251973 missense probably benign 0.08
R7444:Wdhd1 UTSW 14 47251948 nonsense probably null
R7496:Wdhd1 UTSW 14 47274024 missense probably benign 0.39
R7503:Wdhd1 UTSW 14 47250791 missense probably benign 0.25
R8323:Wdhd1 UTSW 14 47274795 missense possibly damaging 0.85
R8338:Wdhd1 UTSW 14 47268663 missense probably benign
R8363:Wdhd1 UTSW 14 47276532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCACTAGAGCAAAACATAGTGTG -3'
(R):5'- AGACTGAGTTATAGTGCGTGAGTC -3'

Sequencing Primer
(F):5'- GTACTGGTGTTTACAGCCAATTC -3'
(R):5'- ATAGTGCGTGAGTCTGTGTC -3'
Posted On2020-07-28