Incidental Mutation 'R8317:Parn'
ID 641777
Institutional Source Beutler Lab
Gene Symbol Parn
Ensembl Gene ENSMUSG00000022685
Gene Name poly(A)-specific ribonuclease (deadenylation nuclease)
Synonyms DAN, 1200003I18Rik
MMRRC Submission 067721-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R8317 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 13355828-13486035 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 13358964 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamine at position 593 (K593Q)
Ref Sequence ENSEMBL: ENSMUSP00000055969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058884]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000058884
AA Change: K593Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: K593Q

DomainStartEndE-ValueType
Pfam:CAF1 3 383 2.7e-86 PFAM
Pfam:R3H 172 236 2.8e-13 PFAM
Pfam:RNA_bind 430 508 2.2e-37 PFAM
low complexity region 564 578 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 C T 13: 81,723,236 (GRCm39) V621M probably damaging Het
Adipor1 C T 1: 134,355,905 (GRCm39) R235W probably benign Het
Agbl1 T A 7: 76,071,929 (GRCm39) M594K unknown Het
Ang2 A G 14: 51,433,349 (GRCm39) V11A probably benign Het
Ccl25 A G 8: 4,404,138 (GRCm39) N80S probably benign Het
Cd19 A T 7: 126,012,615 (GRCm39) C259* probably null Het
Cd209b A T 8: 3,972,018 (GRCm39) I177N probably damaging Het
Cdc20 C A 4: 118,294,323 (GRCm39) probably benign Het
Cdh23 A T 10: 60,147,037 (GRCm39) probably null Het
Cdh23 G A 10: 60,272,568 (GRCm39) R536W probably damaging Het
Cfap299 A C 5: 98,885,459 (GRCm39) H122P probably benign Het
Chd6 T C 2: 160,832,241 (GRCm39) D977G probably damaging Het
Cilk1 T A 9: 78,060,933 (GRCm39) V193E probably damaging Het
Csl T G 10: 99,594,900 (GRCm39) H55P probably damaging Het
Cstf2t G A 19: 31,061,648 (GRCm39) A395T probably benign Het
Dhx58 A T 11: 100,594,388 (GRCm39) I101N probably damaging Het
Dlg5 A C 14: 24,241,298 (GRCm39) S200A probably damaging Het
Epb41 C A 4: 131,684,961 (GRCm39) G86V Het
Fat4 T C 3: 39,012,659 (GRCm39) V2318A possibly damaging Het
Fbxo32 A T 15: 58,068,626 (GRCm39) F119I probably damaging Het
Flacc1 T C 1: 58,715,707 (GRCm39) K170E possibly damaging Het
Fndc1 A T 17: 8,019,720 (GRCm39) L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,052,866 (GRCm39) probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 141,827,553 (GRCm39) probably benign Het
Gpr63 A T 4: 25,008,223 (GRCm39) T316S probably damaging Het
Il16 T C 7: 83,304,538 (GRCm39) T665A probably benign Het
Lama5 T C 2: 179,848,784 (GRCm39) N272S probably damaging Het
Map3k1 T C 13: 111,894,696 (GRCm39) Y660C probably damaging Het
Mbd3l1 C A 9: 18,396,117 (GRCm39) L81I probably benign Het
Morc3 C A 16: 93,659,417 (GRCm39) Q442K probably benign Het
Muc16 G A 9: 18,569,339 (GRCm39) T1060I unknown Het
Myh11 T A 16: 14,025,941 (GRCm39) D1343V Het
Myh15 C A 16: 48,940,381 (GRCm39) T777N probably damaging Het
Nbn T G 4: 15,970,893 (GRCm39) L292W probably damaging Het
Ndufb11b A G 15: 81,864,978 (GRCm39) Y73C probably damaging Het
Nebl A G 2: 17,355,568 (GRCm39) M195T possibly damaging Het
Net1 T C 13: 3,957,856 (GRCm39) K66E possibly damaging Het
Nod1 T C 6: 54,920,425 (GRCm39) Y631C probably damaging Het
Nxf1 A G 19: 8,748,407 (GRCm39) H12R probably benign Het
Onecut3 T C 10: 80,331,161 (GRCm39) L107P unknown Het
Opa1 T G 16: 29,432,962 (GRCm39) I512S probably damaging Het
P3h3 C T 6: 124,832,116 (GRCm39) G257R probably damaging Het
Pappa2 A G 1: 158,592,530 (GRCm39) C1616R probably damaging Het
Pcare A C 17: 72,056,197 (GRCm39) L1160R probably benign Het
Polr3g T C 13: 81,826,302 (GRCm39) K173R unknown Het
Prcp A G 7: 92,524,598 (GRCm39) T18A probably benign Het
Sash1 G A 10: 8,605,150 (GRCm39) T1080M possibly damaging Het
Skap2 A G 6: 51,884,865 (GRCm39) probably null Het
Spmip9 C A 6: 70,890,276 (GRCm39) W172L possibly damaging Het
Srebf1 C A 11: 60,091,483 (GRCm39) S1014I possibly damaging Het
Stk32b C T 5: 37,612,319 (GRCm39) E356K probably damaging Het
Tjp3 T A 10: 81,116,324 (GRCm39) T257S probably benign Het
Trf A G 9: 103,094,715 (GRCm39) Y448H probably damaging Het
Tsnaxip1 G C 8: 106,554,438 (GRCm39) R7P probably benign Het
Vmn1r208 G C 13: 22,956,947 (GRCm39) I183M probably benign Het
Vmn2r67 T A 7: 84,785,834 (GRCm39) M724L probably benign Het
Wdhd1 A T 14: 47,500,994 (GRCm39) H469Q probably damaging Het
Zbtb7a G C 10: 80,980,784 (GRCm39) G326A probably benign Het
Zfp493 G A 13: 67,931,958 (GRCm39) R19H probably benign Het
Zfp932 A T 5: 110,156,922 (GRCm39) K207* probably null Het
Other mutations in Parn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Parn APN 16 13,485,467 (GRCm39) missense probably benign
IGL02030:Parn APN 16 13,482,514 (GRCm39) splice site probably null
IGL02179:Parn APN 16 13,485,456 (GRCm39) missense probably benign 0.00
IGL02336:Parn APN 16 13,384,567 (GRCm39) missense probably damaging 1.00
arlette UTSW 16 13,424,035 (GRCm39) missense probably damaging 1.00
PIT4453001:Parn UTSW 16 13,425,145 (GRCm39) missense probably benign 0.00
PIT4651001:Parn UTSW 16 13,449,431 (GRCm39) missense probably benign 0.25
R0388:Parn UTSW 16 13,472,340 (GRCm39) missense possibly damaging 0.72
R0485:Parn UTSW 16 13,472,299 (GRCm39) splice site probably benign
R0625:Parn UTSW 16 13,458,158 (GRCm39) missense probably benign 0.02
R1104:Parn UTSW 16 13,485,449 (GRCm39) missense probably damaging 0.99
R1299:Parn UTSW 16 13,482,593 (GRCm39) missense probably benign 0.10
R1356:Parn UTSW 16 13,468,538 (GRCm39) nonsense probably null
R2067:Parn UTSW 16 13,420,933 (GRCm39) missense probably damaging 1.00
R2111:Parn UTSW 16 13,420,933 (GRCm39) missense probably damaging 1.00
R2397:Parn UTSW 16 13,384,518 (GRCm39) missense probably benign
R4473:Parn UTSW 16 13,482,549 (GRCm39) missense probably benign 0.00
R4474:Parn UTSW 16 13,482,549 (GRCm39) missense probably benign 0.00
R4475:Parn UTSW 16 13,482,549 (GRCm39) missense probably benign 0.00
R4476:Parn UTSW 16 13,482,549 (GRCm39) missense probably benign 0.00
R4665:Parn UTSW 16 13,358,967 (GRCm39) missense probably benign 0.19
R4795:Parn UTSW 16 13,424,066 (GRCm39) missense probably benign 0.06
R5122:Parn UTSW 16 13,472,311 (GRCm39) critical splice donor site probably null
R5226:Parn UTSW 16 13,443,416 (GRCm39) missense probably benign
R5355:Parn UTSW 16 13,485,886 (GRCm39) missense possibly damaging 0.92
R5570:Parn UTSW 16 13,483,794 (GRCm39) missense probably damaging 0.98
R5979:Parn UTSW 16 13,424,035 (GRCm39) missense probably damaging 1.00
R6009:Parn UTSW 16 13,485,428 (GRCm39) missense probably damaging 1.00
R6173:Parn UTSW 16 13,469,675 (GRCm39) missense possibly damaging 0.82
R6493:Parn UTSW 16 13,474,789 (GRCm39) missense probably damaging 1.00
R7055:Parn UTSW 16 13,443,998 (GRCm39) missense possibly damaging 0.80
R7278:Parn UTSW 16 13,443,927 (GRCm39) splice site probably null
R7391:Parn UTSW 16 13,485,870 (GRCm39) splice site probably null
R7706:Parn UTSW 16 13,425,117 (GRCm39) missense probably damaging 1.00
R8188:Parn UTSW 16 13,359,020 (GRCm39) missense probably benign 0.01
R8326:Parn UTSW 16 13,483,835 (GRCm39) missense probably benign 0.00
R8419:Parn UTSW 16 13,466,338 (GRCm39) missense probably benign 0.11
R8433:Parn UTSW 16 13,485,413 (GRCm39) missense probably damaging 1.00
R8475:Parn UTSW 16 13,425,113 (GRCm39) critical splice donor site probably null
R8847:Parn UTSW 16 13,446,270 (GRCm39) nonsense probably null
R8958:Parn UTSW 16 13,466,322 (GRCm39) missense possibly damaging 0.64
R8988:Parn UTSW 16 13,466,281 (GRCm39) critical splice donor site probably null
R9277:Parn UTSW 16 13,482,519 (GRCm39) critical splice donor site probably null
R9476:Parn UTSW 16 13,358,942 (GRCm39) missense probably benign 0.10
R9510:Parn UTSW 16 13,358,942 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ATTCCTCAATACATCAGGCCCATG -3'
(R):5'- ACACGTTGATAGGGTCTGTG -3'

Sequencing Primer
(F):5'- TACATCAGGCCCATGGGTAC -3'
(R):5'- ATGTCTGAGGCATGTCCCAG -3'
Posted On 2020-07-28