Incidental Mutation 'R8317:Myh15'
ID641780
Institutional Source Beutler Lab
Gene Symbol Myh15
Ensembl Gene ENSMUSG00000092009
Gene Namemyosin, heavy chain 15
SynonymsEG667772
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location49057486-49199104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 49120018 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 777 (T777N)
Ref Sequence ENSEMBL: ENSMUSP00000127539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168680]
Predicted Effect probably damaging
Transcript: ENSMUST00000168680
AA Change: T777N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127539
Gene: ENSMUSG00000092009
AA Change: T777N

DomainStartEndE-ValueType
Pfam:Myosin_N 30 70 5.2e-12 PFAM
MYSc 76 770 N/A SMART
Pfam:Myosin_tail_1 836 1915 9.5e-118 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Myh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Myh15 APN 16 49165813 missense probably damaging 0.98
IGL01095:Myh15 APN 16 49132015 missense probably damaging 1.00
IGL01343:Myh15 APN 16 49155677 missense probably benign 0.09
IGL01474:Myh15 APN 16 49132098 missense probably damaging 1.00
IGL01572:Myh15 APN 16 49100222 missense possibly damaging 0.55
IGL01595:Myh15 APN 16 49172949 missense probably damaging 1.00
IGL01632:Myh15 APN 16 49061511 missense probably benign 0.00
IGL01638:Myh15 APN 16 49069480 missense probably damaging 1.00
IGL01667:Myh15 APN 16 49195579 missense probably benign 0.20
IGL01715:Myh15 APN 16 49057484 unclassified probably benign
IGL01833:Myh15 APN 16 49114058 missense probably damaging 1.00
IGL02004:Myh15 APN 16 49110529 splice site probably benign
IGL02033:Myh15 APN 16 49145344 missense probably benign 0.05
IGL02148:Myh15 APN 16 49116315 missense probably damaging 1.00
IGL02225:Myh15 APN 16 49091163 missense probably benign 0.14
IGL02249:Myh15 APN 16 49110484 missense probably damaging 0.99
IGL02505:Myh15 APN 16 49117263 missense possibly damaging 0.90
IGL02622:Myh15 APN 16 49176954 missense probably benign 0.02
IGL02814:Myh15 APN 16 49145438 splice site probably benign
IGL02869:Myh15 APN 16 49145404 missense probably benign
IGL02879:Myh15 APN 16 49173059 missense possibly damaging 0.68
IGL02881:Myh15 APN 16 49117265 missense possibly damaging 0.51
IGL03077:Myh15 APN 16 49096538 missense probably benign 0.10
IGL03354:Myh15 APN 16 49172010 missense probably benign 0.01
IGL03411:Myh15 APN 16 49159967 missense possibly damaging 0.58
ANU74:Myh15 UTSW 16 49172932 missense possibly damaging 0.58
P0027:Myh15 UTSW 16 49081208 missense possibly damaging 0.77
PIT1430001:Myh15 UTSW 16 49196891 critical splice donor site probably null
R0017:Myh15 UTSW 16 49163060 missense probably damaging 0.97
R0038:Myh15 UTSW 16 49071141 splice site probably benign
R0149:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0361:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0373:Myh15 UTSW 16 49182959 missense possibly damaging 0.86
R0433:Myh15 UTSW 16 49145236 missense probably damaging 1.00
R0525:Myh15 UTSW 16 49132051 missense probably benign 0.03
R0586:Myh15 UTSW 16 49171887 splice site probably benign
R0601:Myh15 UTSW 16 49061581 missense probably damaging 1.00
R0717:Myh15 UTSW 16 49142993 missense probably benign 0.03
R0963:Myh15 UTSW 16 49132149 missense probably damaging 0.97
R1075:Myh15 UTSW 16 49120054 missense possibly damaging 0.63
R1143:Myh15 UTSW 16 49065086 missense probably benign 0.02
R1200:Myh15 UTSW 16 49096519 missense probably damaging 1.00
R1644:Myh15 UTSW 16 49132203 missense probably benign 0.12
R1646:Myh15 UTSW 16 49195568 missense probably damaging 1.00
R1720:Myh15 UTSW 16 49092782 missense probably damaging 1.00
R1768:Myh15 UTSW 16 49163135 missense probably benign 0.27
R1881:Myh15 UTSW 16 49071083 missense probably damaging 0.98
R2048:Myh15 UTSW 16 49155565 missense probably damaging 0.99
R2064:Myh15 UTSW 16 49155621 missense possibly damaging 0.50
R2184:Myh15 UTSW 16 49137511 missense probably damaging 0.99
R2212:Myh15 UTSW 16 49138732 missense probably benign 0.02
R2216:Myh15 UTSW 16 49165838 nonsense probably null
R2321:Myh15 UTSW 16 49113073 missense possibly damaging 0.93
R2327:Myh15 UTSW 16 49142950 missense probably benign 0.01
R2395:Myh15 UTSW 16 49069514 missense probably benign 0.04
R2399:Myh15 UTSW 16 49137589 missense probably damaging 0.97
R3413:Myh15 UTSW 16 49138732 missense probably benign 0.02
R4234:Myh15 UTSW 16 49163042 missense probably benign 0.04
R4382:Myh15 UTSW 16 49142943 missense probably benign 0.03
R4421:Myh15 UTSW 16 49109344 missense probably damaging 0.99
R4580:Myh15 UTSW 16 49065025 missense possibly damaging 0.93
R4657:Myh15 UTSW 16 49172058 nonsense probably null
R4780:Myh15 UTSW 16 49120057 missense probably benign 0.13
R5004:Myh15 UTSW 16 49132048 missense probably damaging 0.99
R5175:Myh15 UTSW 16 49069426 missense possibly damaging 0.85
R5189:Myh15 UTSW 16 49101507 missense probably benign 0.20
R5311:Myh15 UTSW 16 49165841 missense possibly damaging 0.94
R5318:Myh15 UTSW 16 49110471 missense probably damaging 0.99
R5404:Myh15 UTSW 16 49159978 missense probably benign 0.15
R5415:Myh15 UTSW 16 49117295 missense probably null 1.00
R5558:Myh15 UTSW 16 49069537 missense probably benign 0.32
R5977:Myh15 UTSW 16 49153503 missense probably damaging 1.00
R6004:Myh15 UTSW 16 49159699 missense probably benign 0.00
R6275:Myh15 UTSW 16 49145247 missense probably benign 0.00
R6381:Myh15 UTSW 16 49101481 missense probably damaging 1.00
R6448:Myh15 UTSW 16 49171932 missense probably damaging 0.99
R6516:Myh15 UTSW 16 49137633 missense probably benign 0.19
R6752:Myh15 UTSW 16 49182927 missense probably damaging 1.00
R6847:Myh15 UTSW 16 49145088 missense possibly damaging 0.70
R6868:Myh15 UTSW 16 49069403 missense probably damaging 1.00
R6889:Myh15 UTSW 16 49153111 missense possibly damaging 0.75
R6896:Myh15 UTSW 16 49113071 missense probably benign 0.44
R6955:Myh15 UTSW 16 49081235 critical splice donor site probably null
R6984:Myh15 UTSW 16 49110412 missense probably damaging 1.00
R7046:Myh15 UTSW 16 49109299 nonsense probably null
R7095:Myh15 UTSW 16 49171909 missense possibly damaging 0.90
R7098:Myh15 UTSW 16 49177057 missense possibly damaging 0.53
R7134:Myh15 UTSW 16 49081342 missense possibly damaging 0.86
R7159:Myh15 UTSW 16 49061574 missense probably damaging 0.97
R7244:Myh15 UTSW 16 49196786 missense probably damaging 1.00
R7278:Myh15 UTSW 16 49091105 missense probably damaging 0.98
R7309:Myh15 UTSW 16 49096465 missense probably benign 0.34
R7327:Myh15 UTSW 16 49173006 missense possibly damaging 0.88
R7418:Myh15 UTSW 16 49155537 missense possibly damaging 0.69
R7937:Myh15 UTSW 16 49155646 missense probably benign 0.00
R8053:Myh15 UTSW 16 49142939 missense possibly damaging 0.89
R8313:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8315:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8316:Myh15 UTSW 16 49120018 missense probably damaging 0.99
R8342:Myh15 UTSW 16 49092757 missense probably benign
R8379:Myh15 UTSW 16 49081188 missense probably benign
R8445:Myh15 UTSW 16 49120018 missense probably damaging 0.99
X0012:Myh15 UTSW 16 49142978 missense probably damaging 1.00
X0020:Myh15 UTSW 16 49165874 missense probably damaging 1.00
Z1176:Myh15 UTSW 16 49096531 missense probably damaging 0.98
Z1177:Myh15 UTSW 16 49081228 missense probably benign 0.02
Z1177:Myh15 UTSW 16 49155618 missense probably damaging 0.97
Z1177:Myh15 UTSW 16 49159826 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GATTGGTACATAGCTCTCCCAGAG -3'
(R):5'- GAAGACAGAAAGGTCCTTTATACTGTC -3'

Sequencing Primer
(F):5'- CAGAGACTATGCCAGTTGTCCATG -3'
(R):5'- GGAGATTTTCAACACTCAGACTCAG -3'
Posted On2020-07-28