Incidental Mutation 'R8317:Fndc1'
ID641782
Institutional Source Beutler Lab
Gene Symbol Fndc1
Ensembl Gene ENSMUSG00000071984
Gene Namefibronectin type III domain containing 1
Synonyms1110027O12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location7738569-7827302 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 7800888 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 153 (L153*)
Ref Sequence ENSEMBL: ENSMUSP00000126701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097425] [ENSMUST00000167580] [ENSMUST00000169126]
Predicted Effect probably benign
Transcript: ENSMUST00000097425
SMART Domains Protein: ENSMUSP00000095036
Gene: ENSMUSG00000071984

DomainStartEndE-ValueType
Blast:FN3 1 50 6e-25 BLAST
FN3 54 137 7.82e-4 SMART
FN3 156 240 1.48e-4 SMART
FN3 256 340 3.67e-9 SMART
low complexity region 377 388 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 646 676 N/A INTRINSIC
low complexity region 766 777 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 1021 1027 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
Blast:FN3 1227 1276 2e-18 BLAST
low complexity region 1277 1354 N/A INTRINSIC
low complexity region 1395 1403 N/A INTRINSIC
low complexity region 1407 1423 N/A INTRINSIC
FN3 1494 1577 4.32e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167580
SMART Domains Protein: ENSMUSP00000130996
Gene: ENSMUSG00000071984

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FN3 38 121 7.82e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169126
AA Change: L153*
SMART Domains Protein: ENSMUSP00000126701
Gene: ENSMUSG00000071984
AA Change: L153*

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
FN3 37 117 1.22e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Fndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Fndc1 APN 17 7765254 missense unknown
IGL00590:Fndc1 APN 17 7765101 missense unknown
IGL00765:Fndc1 APN 17 7772693 missense unknown
IGL00904:Fndc1 APN 17 7756363 missense probably benign 0.35
IGL01153:Fndc1 APN 17 7780042 critical splice donor site probably null
IGL01557:Fndc1 APN 17 7756389 missense probably damaging 0.99
IGL02493:Fndc1 APN 17 7775545 missense unknown
IGL02501:Fndc1 APN 17 7765398 missense unknown
IGL02503:Fndc1 APN 17 7771516 missense unknown
IGL02887:Fndc1 APN 17 7773638 missense unknown
IGL03348:Fndc1 APN 17 7772647 missense unknown
pinnacle UTSW 17 7773322 missense unknown
spire UTSW 17 7771480 missense unknown
IGL02988:Fndc1 UTSW 17 7753523 missense possibly damaging 0.95
PIT4466001:Fndc1 UTSW 17 7750374 missense probably damaging 1.00
R0336:Fndc1 UTSW 17 7765107 missense unknown
R0403:Fndc1 UTSW 17 7753723 missense probably damaging 1.00
R0403:Fndc1 UTSW 17 7775588 splice site probably null
R0538:Fndc1 UTSW 17 7784341 splice site probably benign
R0646:Fndc1 UTSW 17 7741673 missense possibly damaging 0.92
R1140:Fndc1 UTSW 17 7775426 missense unknown
R1523:Fndc1 UTSW 17 7773209 missense unknown
R1609:Fndc1 UTSW 17 7772766 missense unknown
R1632:Fndc1 UTSW 17 7773200 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R2004:Fndc1 UTSW 17 7804929 missense probably damaging 1.00
R2007:Fndc1 UTSW 17 7778748 unclassified probably benign
R2128:Fndc1 UTSW 17 7778665 unclassified probably benign
R2187:Fndc1 UTSW 17 7741772 missense probably damaging 1.00
R2251:Fndc1 UTSW 17 7753607 missense probably damaging 1.00
R2322:Fndc1 UTSW 17 7789015 missense probably damaging 0.98
R2425:Fndc1 UTSW 17 7805018 missense probably damaging 1.00
R2921:Fndc1 UTSW 17 7804875 missense probably damaging 0.98
R2985:Fndc1 UTSW 17 7756323 missense possibly damaging 0.93
R3436:Fndc1 UTSW 17 7750357 missense probably damaging 0.99
R3499:Fndc1 UTSW 17 7753584 missense possibly damaging 0.70
R3508:Fndc1 UTSW 17 7765108 nonsense probably null
R3766:Fndc1 UTSW 17 7784421 missense probably damaging 1.00
R3813:Fndc1 UTSW 17 7773322 missense unknown
R3814:Fndc1 UTSW 17 7773322 missense unknown
R4031:Fndc1 UTSW 17 7769752 nonsense probably null
R4544:Fndc1 UTSW 17 7773544 missense unknown
R4583:Fndc1 UTSW 17 7739249 missense probably damaging 1.00
R4619:Fndc1 UTSW 17 7765204 missense unknown
R4700:Fndc1 UTSW 17 7771480 missense unknown
R4743:Fndc1 UTSW 17 7772279 nonsense probably null
R4803:Fndc1 UTSW 17 7753706 missense probably damaging 0.98
R4862:Fndc1 UTSW 17 7769735 missense unknown
R4876:Fndc1 UTSW 17 7771639 missense unknown
R5057:Fndc1 UTSW 17 7771970 nonsense probably null
R5327:Fndc1 UTSW 17 7772708 missense unknown
R5372:Fndc1 UTSW 17 7765210 missense unknown
R5533:Fndc1 UTSW 17 7772776 missense unknown
R5754:Fndc1 UTSW 17 7769753 missense unknown
R5762:Fndc1 UTSW 17 7771534 missense unknown
R5830:Fndc1 UTSW 17 7789086 missense possibly damaging 0.87
R5924:Fndc1 UTSW 17 7773610 missense unknown
R6147:Fndc1 UTSW 17 7753762 splice site probably null
R6175:Fndc1 UTSW 17 7772647 missense unknown
R6303:Fndc1 UTSW 17 7758485 missense probably damaging 0.98
R6377:Fndc1 UTSW 17 7769735 missense unknown
R6704:Fndc1 UTSW 17 7771810 missense unknown
R6857:Fndc1 UTSW 17 7772170 missense unknown
R6865:Fndc1 UTSW 17 7772840 missense unknown
R7069:Fndc1 UTSW 17 7769735 missense unknown
R7153:Fndc1 UTSW 17 7801645 missense probably damaging 1.00
R7159:Fndc1 UTSW 17 7800931 missense probably damaging 0.97
R7359:Fndc1 UTSW 17 7813486 splice site probably null
R7731:Fndc1 UTSW 17 7773439 missense unknown
R7743:Fndc1 UTSW 17 7765137 missense unknown
R7884:Fndc1 UTSW 17 7773197 missense unknown
R8071:Fndc1 UTSW 17 7772530 missense unknown
R8100:Fndc1 UTSW 17 7771853 missense unknown
R8362:Fndc1 UTSW 17 7782375 missense unknown
Z1088:Fndc1 UTSW 17 7782479 missense probably damaging 0.96
Z1176:Fndc1 UTSW 17 7773593 nonsense probably null
Z1176:Fndc1 UTSW 17 7804877 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGGACAGTTCTACCATCTTAGCC -3'
(R):5'- TCAAGGACCGTTTGACTAGTCAC -3'

Sequencing Primer
(F):5'- TTGCTGATAAACACAGACGTTGCC -3'
(R):5'- ACCGTTTGACTAGTCACTGAGG -3'
Posted On2020-07-28