Incidental Mutation 'R8317:Nxf1'
ID641784
Institutional Source Beutler Lab
Gene Symbol Nxf1
Ensembl Gene ENSMUSG00000010097
Gene Namenuclear RNA export factor 1
SynonymsTip associated protein, Mex67, TAP, Mvb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8757073-8772475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8771043 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 12 (H12R)
Ref Sequence ENSEMBL: ENSMUSP00000010248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003777] [ENSMUST00000010241] [ENSMUST00000010248] [ENSMUST00000010249] [ENSMUST00000176496] [ENSMUST00000176610] [ENSMUST00000177056] [ENSMUST00000177216] [ENSMUST00000184663] [ENSMUST00000184970] [ENSMUST00000189739]
Predicted Effect probably benign
Transcript: ENSMUST00000003777
SMART Domains Protein: ENSMUSP00000003777
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 16 79 9.03e-28 SMART
Pfam:DUF1546 248 339 4.5e-29 PFAM
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000010241
SMART Domains Protein: ENSMUSP00000010241
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 115 198 7.6e-42 PFAM
low complexity region 258 274 N/A INTRINSIC
LRRcap 333 351 1.44e0 SMART
Pfam:NTF2 385 535 1.3e-29 PFAM
TAP_C 555 618 1.85e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000010248
AA Change: H12R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010248
Gene: ENSMUSG00000010097
AA Change: H12R

DomainStartEndE-ValueType
Pfam:TMEM223 32 197 6.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000010249
SMART Domains Protein: ENSMUSP00000010249
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 45 62 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176496
SMART Domains Protein: ENSMUSP00000135090
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 224 315 4.3e-29 PFAM
low complexity region 541 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176610
SMART Domains Protein: ENSMUSP00000135193
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:TAF6_C 249 338 6.6e-22 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177056
SMART Domains Protein: ENSMUSP00000135028
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 10 73 9.03e-28 SMART
Pfam:DUF1546 242 333 4.5e-29 PFAM
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177216
SMART Domains Protein: ENSMUSP00000135220
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 17 80 9.03e-28 SMART
Pfam:DUF1546 249 340 6.4e-29 PFAM
low complexity region 566 577 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184663
SMART Domains Protein: ENSMUSP00000139090
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
LRRcap 28 46 1.44e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184826
Predicted Effect probably benign
Transcript: ENSMUST00000184970
SMART Domains Protein: ENSMUSP00000139124
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 112 199 2.4e-45 PFAM
low complexity region 258 274 N/A INTRINSIC
Pfam:LRR_1 291 314 3.2e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189739
SMART Domains Protein: ENSMUSP00000140136
Gene: ENSMUSG00000003680

DomainStartEndE-ValueType
TAF 16 79 3.8e-31 SMART
Pfam:DUF1546 223 314 6.3e-26 PFAM
low complexity region 540 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene shuttles between the nucleus and the cytoplasm and binds in vivo to poly(A)+ RNA. It is the vertebrate homologue of the yeast protein Mex67p. The encoded protein overcomes the mRNA export block caused by the presence of saturating amounts of CTE (constitutive transport element) RNA of type D retroviruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some alleles are able to suppress defects caused by retrovirus insertion mutations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Cstf2t G A 19: 31,084,248 A395T probably benign Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Nxf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Nxf1 APN 19 8762742 missense possibly damaging 0.95
IGL02318:Nxf1 APN 19 8764150 critical splice donor site probably null
IGL03383:Nxf1 APN 19 8763697 missense probably damaging 1.00
Chance UTSW 19 8769182 missense probably damaging 1.00
Possibility UTSW 19 8767744 missense probably damaging 1.00
Probability UTSW 19 8764317 missense probably benign 0.01
R0125:Nxf1 UTSW 19 8762806 missense probably benign 0.37
R0362:Nxf1 UTSW 19 8764151 critical splice donor site probably null
R0374:Nxf1 UTSW 19 8767739 missense possibly damaging 0.86
R0403:Nxf1 UTSW 19 8765028 missense probably damaging 1.00
R0883:Nxf1 UTSW 19 8764591 missense probably damaging 1.00
R1004:Nxf1 UTSW 19 8764317 missense probably benign 0.01
R1068:Nxf1 UTSW 19 8762754 missense probably damaging 0.97
R1503:Nxf1 UTSW 19 8762436 missense probably benign
R1669:Nxf1 UTSW 19 8772131 missense possibly damaging 0.93
R1679:Nxf1 UTSW 19 8769074 missense probably benign
R4424:Nxf1 UTSW 19 8766764 utr 3 prime probably benign
R4608:Nxf1 UTSW 19 8762763 missense probably benign 0.03
R4783:Nxf1 UTSW 19 8766798 missense probably benign 0.01
R4969:Nxf1 UTSW 19 8762305 splice site probably null
R5233:Nxf1 UTSW 19 8763929 missense possibly damaging 0.67
R5370:Nxf1 UTSW 19 8772140 missense probably damaging 1.00
R6024:Nxf1 UTSW 19 8767744 missense probably damaging 1.00
R6058:Nxf1 UTSW 19 8767822 missense probably damaging 1.00
R6063:Nxf1 UTSW 19 8767787 missense possibly damaging 0.46
R6293:Nxf1 UTSW 19 8769182 missense probably damaging 1.00
R6378:Nxf1 UTSW 19 8764546 missense probably benign 0.19
R8170:Nxf1 UTSW 19 8771050 missense probably benign 0.02
RF021:Nxf1 UTSW 19 8772309 missense probably damaging 1.00
X0024:Nxf1 UTSW 19 8763764 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CGGAAGATTGAGCCTCATGG -3'
(R):5'- TCTGGACAAGGCTGCAACAG -3'

Sequencing Primer
(F):5'- AGATTGAGCCTCATGGTGCCAG -3'
(R):5'- TGCAACAGCCAGGGAGGTC -3'
Posted On2020-07-28