Incidental Mutation 'R8317:Cstf2t'
ID641785
Institutional Source Beutler Lab
Gene Symbol Cstf2t
Ensembl Gene ENSMUSG00000053536
Gene Namecleavage stimulation factor, 3' pre-RNA subunit 2, tau
Synonyms64kDa, tCstF-64
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R8317 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location31082841-31086590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31084248 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 395 (A395T)
Ref Sequence ENSEMBL: ENSMUSP00000093831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000066039] [ENSMUST00000073581]
Predicted Effect probably benign
Transcript: ENSMUST00000065067
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066039
AA Change: A395T

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093831
Gene: ENSMUSG00000053536
AA Change: A395T

DomainStartEndE-ValueType
RRM 17 90 6.19e-29 SMART
Pfam:CSTF2_hinge 112 191 5.4e-32 PFAM
low complexity region 202 236 N/A INTRINSIC
low complexity region 240 257 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 321 339 N/A INTRINSIC
low complexity region 364 379 N/A INTRINSIC
low complexity region 508 584 N/A INTRINSIC
Pfam:CSTF_C 588 628 7.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073581
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a targeted null allele are infertile due to low sperm counts, significant developmental defects in spermiogenesis, and variable abnormalities in epididymal sperm morphology and motility consistent with oligoasthenoteratozoospermia. Homozygous null females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A C 5: 98,737,600 H122P probably benign Het
1700029P11Rik A G 15: 81,980,777 Y73C probably damaging Het
Adgrv1 C T 13: 81,575,117 V621M probably damaging Het
Adipor1 C T 1: 134,428,167 R235W probably benign Het
Agbl1 T A 7: 76,422,181 M594K unknown Het
Als2cr12 T C 1: 58,676,548 K170E possibly damaging Het
Ang2 A G 14: 51,195,892 V11A probably benign Het
BC027072 A C 17: 71,749,202 L1160R probably benign Het
Ccl25 A G 8: 4,354,138 N80S probably benign Het
Cd19 A T 7: 126,413,443 C259* probably null Het
Cd209b A T 8: 3,922,018 I177N probably damaging Het
Cdc20 C A 4: 118,437,126 probably benign Het
Cdh23 A T 10: 60,311,258 probably null Het
Cdh23 G A 10: 60,436,789 R536W probably damaging Het
Chd6 T C 2: 160,990,321 D977G probably damaging Het
Csl T G 10: 99,759,038 H55P probably damaging Het
Dhx58 A T 11: 100,703,562 I101N probably damaging Het
Dlg5 A C 14: 24,191,230 S200A probably damaging Het
Epb41 C A 4: 131,957,650 G86V Het
Fat4 T C 3: 38,958,510 V2318A possibly damaging Het
Fbxo32 A T 15: 58,205,230 F119I probably damaging Het
Fndc1 A T 17: 7,800,888 L153* probably null Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,905 probably benign Het
Gm4559 CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT 7: 142,273,816 probably benign Het
Gpr63 A T 4: 25,008,223 T316S probably damaging Het
Ick T A 9: 78,153,651 V193E probably damaging Het
Il16 T C 7: 83,655,330 T665A probably benign Het
Lama5 T C 2: 180,206,991 N272S probably damaging Het
Map3k1 T C 13: 111,758,162 Y660C probably damaging Het
Mbd3l1 C A 9: 18,484,821 L81I probably benign Het
Morc3 C A 16: 93,862,529 Q442K probably benign Het
Muc16 G A 9: 18,658,043 T1060I unknown Het
Myh11 T A 16: 14,208,077 D1343V Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nbn T G 4: 15,970,893 L292W probably damaging Het
Nebl A G 2: 17,350,757 M195T possibly damaging Het
Net1 T C 13: 3,907,856 K66E possibly damaging Het
Nod1 T C 6: 54,943,440 Y631C probably damaging Het
Nxf1 A G 19: 8,771,043 H12R probably benign Het
Onecut3 T C 10: 80,495,327 L107P unknown Het
Opa1 T G 16: 29,614,144 I512S probably damaging Het
P3h3 C T 6: 124,855,153 G257R probably damaging Het
Pappa2 A G 1: 158,764,960 C1616R probably damaging Het
Parn T G 16: 13,541,100 K593Q probably damaging Het
Polr3g T C 13: 81,678,183 K173R unknown Het
Prcp A G 7: 92,875,390 T18A probably benign Het
Sash1 G A 10: 8,729,386 T1080M possibly damaging Het
Skap2 A G 6: 51,907,885 probably null Het
Srebf1 C A 11: 60,200,657 S1014I possibly damaging Het
Stk32b C T 5: 37,454,975 E356K probably damaging Het
Tex37 C A 6: 70,913,292 W172L possibly damaging Het
Tjp3 T A 10: 81,280,490 T257S probably benign Het
Trf A G 9: 103,217,516 Y448H probably damaging Het
Tsnaxip1 G C 8: 105,827,806 R7P probably benign Het
Vmn1r208 G C 13: 22,772,777 I183M probably benign Het
Vmn2r67 T A 7: 85,136,626 M724L probably benign Het
Wdhd1 A T 14: 47,263,537 H469Q probably damaging Het
Zbtb7a G C 10: 81,144,950 G326A probably benign Het
Zfp493 G A 13: 67,783,839 R19H probably benign Het
Zfp932 A T 5: 110,009,056 K207* probably null Het
Other mutations in Cstf2t
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Cstf2t APN 19 31084338 missense probably benign 0.00
IGL01739:Cstf2t APN 19 31083136 missense probably damaging 1.00
IGL02466:Cstf2t APN 19 31083877 missense possibly damaging 0.88
R0064:Cstf2t UTSW 19 31083299 missense probably damaging 0.99
R0099:Cstf2t UTSW 19 31083831 missense probably benign 0.00
R0197:Cstf2t UTSW 19 31084626 missense probably benign 0.01
R0423:Cstf2t UTSW 19 31084276 missense possibly damaging 0.89
R0883:Cstf2t UTSW 19 31084626 missense probably benign 0.01
R1753:Cstf2t UTSW 19 31083685 missense possibly damaging 0.52
R2206:Cstf2t UTSW 19 31083775 missense probably benign 0.00
R2291:Cstf2t UTSW 19 31084864 missense probably benign 0.36
R3753:Cstf2t UTSW 19 31083295 missense probably damaging 1.00
R4523:Cstf2t UTSW 19 31083082 missense possibly damaging 0.47
R4991:Cstf2t UTSW 19 31084583 missense probably damaging 0.97
R5134:Cstf2t UTSW 19 31084094 missense probably damaging 1.00
R5863:Cstf2t UTSW 19 31083077 missense probably damaging 1.00
R6081:Cstf2t UTSW 19 31083123 missense probably benign 0.10
R6573:Cstf2t UTSW 19 31083780 missense probably benign 0.00
R7408:Cstf2t UTSW 19 31083193 missense possibly damaging 0.94
R7648:Cstf2t UTSW 19 31083592 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCGAGGACTACTGGGAGATG -3'
(R):5'- TCATCGGACCTCTGGAACTAG -3'

Sequencing Primer
(F):5'- GATGCTCCAAATGACCCACGTG -3'
(R):5'- ACCTCTGGAACTAGGGCCAG -3'
Posted On2020-07-28