Incidental Mutation 'R8318:Ddx18'
ID641787
Institutional Source Beutler Lab
Gene Symbol Ddx18
Ensembl Gene ENSMUSG00000001674
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R8318 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location121553835-121567989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121566087 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 56 (A56D)
Ref Sequence ENSEMBL: ENSMUSP00000001724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001724]
Predicted Effect probably benign
Transcript: ENSMUST00000001724
AA Change: A56D

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000001724
Gene: ENSMUSG00000001674
AA Change: A56D

DomainStartEndE-ValueType
coiled coil region 2 32 N/A INTRINSIC
internal_repeat_1 36 75 1.67e-5 PROSPERO
internal_repeat_1 66 105 1.67e-5 PROSPERO
low complexity region 109 117 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
DEXDc 188 393 1.95e-56 SMART
low complexity region 401 417 N/A INTRINSIC
HELICc 429 510 2.84e-26 SMART
DUF4217 550 613 1.65e-26 SMART
low complexity region 620 638 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it is activated by Myc protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 T C 8: 23,115,551 V1145A probably damaging Het
Ankrd35 G A 3: 96,684,722 V775M probably damaging Het
Ankrd63 C T 2: 118,703,240 V67M unknown Het
Arhgef5 T A 6: 43,275,999 probably null Het
Atp13a2 A T 4: 141,007,024 Q1152H probably benign Het
Col7a1 G A 9: 108,958,374 A612T unknown Het
Csgalnact1 T C 8: 68,461,133 E140G probably damaging Het
Dixdc1 T C 9: 50,684,409 probably null Het
Dpys G A 15: 39,784,665 T498I probably benign Het
Ear6 A G 14: 51,854,265 I90V probably benign Het
Egr1 T C 18: 34,863,610 S482P probably damaging Het
Ehbp1 C T 11: 22,137,980 R393Q probably benign Het
Enpep A G 3: 129,270,337 I927T probably damaging Het
Ermard C T 17: 15,022,072 T406I possibly damaging Het
Etl4 T C 2: 20,788,530 S971P probably damaging Het
Fam63a A G 3: 95,292,625 S246G probably damaging Het
Fan1 C A 7: 64,350,055 V861F probably damaging Het
Fbp1 A G 13: 62,865,011 F328L probably benign Het
Fgd5 T A 6: 91,987,496 F237I probably benign Het
Fmn1 T C 2: 113,365,157 S401P unknown Het
Gabbr1 G A 17: 37,062,543 E444K probably benign Het
Htr3b C A 9: 48,964,877 probably benign Het
Ighv1-49 A G 12: 115,055,431 F48S probably damaging Het
Kcnh4 A G 11: 100,752,328 L371P probably damaging Het
Kcnk15 A G 2: 163,858,269 T143A probably damaging Het
Klk1b4 T G 7: 44,210,911 S150A possibly damaging Het
Krt6a A T 15: 101,694,247 M1K probably null Het
Lama2 G A 10: 26,984,338 S3051L probably damaging Het
Lgals4 T C 7: 28,834,515 M38T probably benign Het
Lrrc16a A G 13: 24,036,459 L1094P probably benign Het
Mdn1 T C 4: 32,735,897 probably null Het
Myo18a A G 11: 77,823,389 T770A probably benign Het
Olfr1221 T A 2: 89,111,898 I205F probably benign Het
Olfr1254 C T 2: 89,788,977 C125Y possibly damaging Het
Olfr270 T C 4: 52,971,104 V161A probably benign Het
Pcdhb19 T A 18: 37,497,946 S265T possibly damaging Het
Pcna T C 2: 132,251,428 Y133C probably damaging Het
Polr2b A G 5: 77,335,729 E684G probably benign Het
Pon2 T C 6: 5,265,425 I321V probably benign Het
Prss54 T A 8: 95,564,466 M169L probably damaging Het
Rps3 T A 7: 99,483,731 probably benign Het
Senp1 T C 15: 98,064,867 D312G probably damaging Het
Serpina10 T A 12: 103,616,848 T446S possibly damaging Het
Slc2a5 A G 4: 150,139,658 D241G possibly damaging Het
Slc7a11 A G 3: 50,417,986 probably null Het
Tgfbrap1 G C 1: 43,056,669 C536W probably damaging Het
Trip11 C T 12: 101,912,804 G9S unknown Het
Zfp626 C A 7: 27,818,245 T217K possibly damaging Het
Other mutations in Ddx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Ddx18 APN 1 121564586 missense probably benign 0.00
IGL01999:Ddx18 APN 1 121561728 missense probably benign 0.19
IGL03056:Ddx18 APN 1 121564535 missense probably benign 0.00
IGL03388:Ddx18 APN 1 121565923 missense possibly damaging 0.86
R0550:Ddx18 UTSW 1 121555375 missense probably benign 0.40
R1883:Ddx18 UTSW 1 121567916 start gained probably benign
R1940:Ddx18 UTSW 1 121555224 missense probably damaging 1.00
R2169:Ddx18 UTSW 1 121558409 critical splice donor site probably null
R3113:Ddx18 UTSW 1 121566148 missense possibly damaging 0.65
R3414:Ddx18 UTSW 1 121562149 missense probably benign
R3763:Ddx18 UTSW 1 121561377 missense probably damaging 0.99
R4011:Ddx18 UTSW 1 121562081 missense probably benign 0.01
R4293:Ddx18 UTSW 1 121561392 missense probably benign 0.10
R4333:Ddx18 UTSW 1 121564602 missense probably benign 0.01
R4964:Ddx18 UTSW 1 121566094 missense probably benign 0.00
R5160:Ddx18 UTSW 1 121565879 critical splice donor site probably null
R5187:Ddx18 UTSW 1 121562128 missense probably damaging 0.98
R5259:Ddx18 UTSW 1 121567789 critical splice donor site probably null
R5656:Ddx18 UTSW 1 121561358 missense probably damaging 1.00
R7949:Ddx18 UTSW 1 121555318 missense probably damaging 1.00
R8291:Ddx18 UTSW 1 121560175 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACCAAGAGCTGAAAAGCTATCTG -3'
(R):5'- GGTTCCAGAAAACCCATAATTTCTC -3'

Sequencing Primer
(F):5'- GCTGAAAAGCTATCTGAATGACC -3'
(R):5'- CCATAATTTCTCCTGTGAAGGTCAG -3'
Posted On2020-07-28