Incidental Mutation 'R8318:Slc7a11'
ID 641795
Institutional Source Beutler Lab
Gene Symbol Slc7a11
Ensembl Gene ENSMUSG00000027737
Gene Name solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms sut, System x, x, 9930009M05Rik, xCT
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8318 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 49892526-50443614 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 50417986 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029297] [ENSMUST00000194462]
AlphaFold Q9WTR6
Predicted Effect probably null
Transcript: ENSMUST00000029297
SMART Domains Protein: ENSMUSP00000029297
Gene: ENSMUSG00000027737

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 3.3e-61 PFAM
Pfam:AA_permease 49 478 1.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194462
SMART Domains Protein: ENSMUSP00000141988
Gene: ENSMUSG00000027737

DomainStartEndE-ValueType
Pfam:AA_permease_2 44 469 1.1e-60 PFAM
Pfam:AA_permease 49 479 2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice show a reduction in yellow pigment resulting in dilution of agouti; only pinna hairs are affected in nonagouti mice. Mice homozygous for an ENU-induced allele exhibit decreased survival of LPS-induced macrophages and increased incidence of chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 T C 8: 23,115,551 V1145A probably damaging Het
Ankrd35 G A 3: 96,684,722 V775M probably damaging Het
Ankrd63 C T 2: 118,703,240 V67M unknown Het
Arhgef5 T A 6: 43,275,999 probably null Het
Atp13a2 A T 4: 141,007,024 Q1152H probably benign Het
Col7a1 G A 9: 108,958,374 A612T unknown Het
Csgalnact1 T C 8: 68,461,133 E140G probably damaging Het
Ddx18 G T 1: 121,566,087 A56D probably benign Het
Dixdc1 T C 9: 50,684,409 probably null Het
Dpys G A 15: 39,784,665 T498I probably benign Het
Ear6 A G 14: 51,854,265 I90V probably benign Het
Egr1 T C 18: 34,863,610 S482P probably damaging Het
Ehbp1 C T 11: 22,137,980 R393Q probably benign Het
Enpep A G 3: 129,270,337 I927T probably damaging Het
Ermard C T 17: 15,022,072 T406I possibly damaging Het
Etl4 T C 2: 20,788,530 S971P probably damaging Het
Fam63a A G 3: 95,292,625 S246G probably damaging Het
Fan1 C A 7: 64,350,055 V861F probably damaging Het
Fbp1 A G 13: 62,865,011 F328L probably benign Het
Fgd5 T A 6: 91,987,496 F237I probably benign Het
Fmn1 T C 2: 113,365,157 S401P unknown Het
Gabbr1 G A 17: 37,062,543 E444K probably benign Het
Htr3b C A 9: 48,964,877 probably benign Het
Ighv1-49 A G 12: 115,055,431 F48S probably damaging Het
Kcnh4 A G 11: 100,752,328 L371P probably damaging Het
Kcnk15 A G 2: 163,858,269 T143A probably damaging Het
Klk1b4 T G 7: 44,210,911 S150A possibly damaging Het
Krt6a A T 15: 101,694,247 M1K probably null Het
Lama2 G A 10: 26,984,338 S3051L probably damaging Het
Lgals4 T C 7: 28,834,515 M38T probably benign Het
Lrrc16a A G 13: 24,036,459 L1094P probably benign Het
Mdn1 T C 4: 32,735,897 probably null Het
Myo18a A G 11: 77,823,389 T770A probably benign Het
Olfr1221 T A 2: 89,111,898 I205F probably benign Het
Olfr1254 C T 2: 89,788,977 C125Y possibly damaging Het
Olfr270 T C 4: 52,971,104 V161A probably benign Het
Pcdhb19 T A 18: 37,497,946 S265T possibly damaging Het
Pcna T C 2: 132,251,428 Y133C probably damaging Het
Polr2b A G 5: 77,335,729 E684G probably benign Het
Pon2 T C 6: 5,265,425 I321V probably benign Het
Prss54 T A 8: 95,564,466 M169L probably damaging Het
Rps3 T A 7: 99,483,731 probably benign Het
Senp1 T C 15: 98,064,867 D312G probably damaging Het
Serpina10 T A 12: 103,616,848 T446S possibly damaging Het
Slc2a5 A G 4: 150,139,658 D241G possibly damaging Het
Tgfbrap1 G C 1: 43,056,669 C536W probably damaging Het
Trip11 C T 12: 101,912,804 G9S unknown Het
Zfp626 C A 7: 27,818,245 T217K possibly damaging Het
Other mutations in Slc7a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Slc7a11 APN 3 50427687 missense probably benign 0.06
IGL00990:Slc7a11 APN 3 50379069 missense probably damaging 1.00
IGL01755:Slc7a11 APN 3 50424067 missense probably benign 0.39
IGL03105:Slc7a11 APN 3 50372339 missense possibly damaging 0.67
IGL03141:Slc7a11 APN 3 50381885 missense possibly damaging 0.66
R0468:Slc7a11 UTSW 3 50384051 missense probably damaging 1.00
R0735:Slc7a11 UTSW 3 50424096 missense probably benign 0.00
R1363:Slc7a11 UTSW 3 50424051 missense probably damaging 1.00
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1466:Slc7a11 UTSW 3 50381073 splice site probably null
R1554:Slc7a11 UTSW 3 50381896 missense probably damaging 1.00
R1734:Slc7a11 UTSW 3 50372346 nonsense probably null
R2128:Slc7a11 UTSW 3 50384109 missense probably damaging 0.97
R2504:Slc7a11 UTSW 3 50377746 splice site probably null
R3116:Slc7a11 UTSW 3 50384139 missense probably benign 0.13
R3981:Slc7a11 UTSW 3 50427774 missense probably benign
R4479:Slc7a11 UTSW 3 50417963 intron probably benign
R5117:Slc7a11 UTSW 3 50379150 missense probably damaging 0.99
R5586:Slc7a11 UTSW 3 50443083 missense possibly damaging 0.95
R5621:Slc7a11 UTSW 3 50438875 missense probably damaging 1.00
R5689:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5692:Slc7a11 UTSW 3 50372331 missense probably benign 0.01
R5965:Slc7a11 UTSW 3 50379144 missense probably benign 0.00
R6338:Slc7a11 UTSW 3 50384043 critical splice donor site probably null
R7177:Slc7a11 UTSW 3 50443231 missense probably benign 0.00
R7337:Slc7a11 UTSW 3 50442999 missense possibly damaging 0.50
R7634:Slc7a11 UTSW 3 50424037 splice site probably null
R7756:Slc7a11 UTSW 3 50372360 missense probably benign
R7758:Slc7a11 UTSW 3 50372360 missense probably benign
R7821:Slc7a11 UTSW 3 50381027 missense probably damaging 1.00
R8112:Slc7a11 UTSW 3 50417991 missense possibly damaging 0.92
R8218:Slc7a11 UTSW 3 50424052 missense probably damaging 1.00
R8255:Slc7a11 UTSW 3 50427728 missense probably damaging 0.98
R8396:Slc7a11 UTSW 3 50384129 missense possibly damaging 0.78
R8857:Slc7a11 UTSW 3 50438856 missense probably damaging 1.00
R8967:Slc7a11 UTSW 3 50384115 missense probably benign 0.00
R9044:Slc7a11 UTSW 3 50379183 missense probably benign 0.20
R9104:Slc7a11 UTSW 3 50377633 missense probably benign 0.01
R9404:Slc7a11 UTSW 3 50381039 missense possibly damaging 0.64
R9500:Slc7a11 UTSW 3 50427752 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTTCCTACATTCAGACTATAAGGC -3'
(R):5'- GAGCTTGCCCTACAGCTTAATGG -3'

Sequencing Primer
(F):5'- TTAACTGGCCCACACTGA -3'
(R):5'- GAGAGTTCTCACCAGTTGCC -3'
Posted On 2020-07-28