Incidental Mutation 'R8318:Arhgef5'
ID 641805
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor 5
Synonyms 2210412D05Rik
MMRRC Submission 067855-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8318 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 43242578-43266254 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 43252933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably null
Transcript: ENSMUST00000031750
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182924
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 T C 8: 23,605,567 (GRCm39) V1145A probably damaging Het
Ankrd35 G A 3: 96,592,038 (GRCm39) V775M probably damaging Het
Ankrd63 C T 2: 118,533,721 (GRCm39) V67M unknown Het
Atp13a2 A T 4: 140,734,335 (GRCm39) Q1152H probably benign Het
Carmil1 A G 13: 24,220,442 (GRCm39) L1094P probably benign Het
Col7a1 G A 9: 108,787,442 (GRCm39) A612T unknown Het
Csgalnact1 T C 8: 68,913,785 (GRCm39) E140G probably damaging Het
Ddx18 G T 1: 121,493,816 (GRCm39) A56D probably benign Het
Dixdc1 T C 9: 50,595,709 (GRCm39) probably null Het
Dpys G A 15: 39,648,061 (GRCm39) T498I probably benign Het
Ear6 A G 14: 52,091,722 (GRCm39) I90V probably benign Het
Egr1 T C 18: 34,996,663 (GRCm39) S482P probably damaging Het
Ehbp1 C T 11: 22,087,980 (GRCm39) R393Q probably benign Het
Enpep A G 3: 129,063,986 (GRCm39) I927T probably damaging Het
Ermard C T 17: 15,242,334 (GRCm39) T406I possibly damaging Het
Etl4 T C 2: 20,793,341 (GRCm39) S971P probably damaging Het
Fan1 C A 7: 63,999,803 (GRCm39) V861F probably damaging Het
Fbp1 A G 13: 63,012,825 (GRCm39) F328L probably benign Het
Fgd5 T A 6: 91,964,477 (GRCm39) F237I probably benign Het
Fmn1 T C 2: 113,195,502 (GRCm39) S401P unknown Het
Gabbr1 G A 17: 37,373,435 (GRCm39) E444K probably benign Het
Htr3b C A 9: 48,876,177 (GRCm39) probably benign Het
Ighv1-49 A G 12: 115,019,051 (GRCm39) F48S probably damaging Het
Kcnh4 A G 11: 100,643,154 (GRCm39) L371P probably damaging Het
Kcnk15 A G 2: 163,700,189 (GRCm39) T143A probably damaging Het
Klk1b4 T G 7: 43,860,335 (GRCm39) S150A possibly damaging Het
Krt6a A T 15: 101,602,682 (GRCm39) M1K probably null Het
Lama2 G A 10: 26,860,334 (GRCm39) S3051L probably damaging Het
Lgals4 T C 7: 28,533,940 (GRCm39) M38T probably benign Het
Mdn1 T C 4: 32,735,897 (GRCm39) probably null Het
Mindy1 A G 3: 95,199,936 (GRCm39) S246G probably damaging Het
Myo18a A G 11: 77,714,215 (GRCm39) T770A probably benign Het
Or13d1 T C 4: 52,971,104 (GRCm39) V161A probably benign Het
Or4a81 C T 2: 89,619,321 (GRCm39) C125Y possibly damaging Het
Or4c116 T A 2: 88,942,242 (GRCm39) I205F probably benign Het
Pcdhb19 T A 18: 37,630,999 (GRCm39) S265T possibly damaging Het
Pcna T C 2: 132,093,348 (GRCm39) Y133C probably damaging Het
Polr2b A G 5: 77,483,576 (GRCm39) E684G probably benign Het
Pon2 T C 6: 5,265,425 (GRCm39) I321V probably benign Het
Prss54 T A 8: 96,291,094 (GRCm39) M169L probably damaging Het
Rps3 T A 7: 99,132,938 (GRCm39) probably benign Het
Senp1 T C 15: 97,962,748 (GRCm39) D312G probably damaging Het
Serpina10 T A 12: 103,583,107 (GRCm39) T446S possibly damaging Het
Slc2a5 A G 4: 150,224,115 (GRCm39) D241G possibly damaging Het
Slc7a11 A G 3: 50,372,435 (GRCm39) probably null Het
Tgfbrap1 G C 1: 43,095,829 (GRCm39) C536W probably damaging Het
Trip11 C T 12: 101,879,063 (GRCm39) G9S unknown Het
Zfp626 C A 7: 27,517,670 (GRCm39) T217K possibly damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43,257,203 (GRCm39) nonsense probably null
IGL01341:Arhgef5 APN 6 43,260,925 (GRCm39) missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43,250,962 (GRCm39) missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43,251,538 (GRCm39) missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43,249,345 (GRCm39) missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43,252,064 (GRCm39) missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43,260,916 (GRCm39) missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43,249,869 (GRCm39) nonsense probably null
IGL03292:Arhgef5 APN 6 43,257,180 (GRCm39) missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43,250,934 (GRCm39) missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43,257,585 (GRCm39) missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43,242,555 (GRCm39) splice site probably null
R0206:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43,250,330 (GRCm39) missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43,251,568 (GRCm39) missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43,256,449 (GRCm39) missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43,250,337 (GRCm39) missense probably benign
R1663:Arhgef5 UTSW 6 43,253,899 (GRCm39) missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43,257,133 (GRCm39) missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43,265,616 (GRCm39) missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43,260,252 (GRCm39) missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43,251,354 (GRCm39) missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43,250,724 (GRCm39) missense probably benign
R4205:Arhgef5 UTSW 6 43,250,766 (GRCm39) missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43,251,027 (GRCm39) missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43,252,033 (GRCm39) missense probably benign
R4636:Arhgef5 UTSW 6 43,251,876 (GRCm39) missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43,260,117 (GRCm39) missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43,250,484 (GRCm39) missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43,250,148 (GRCm39) missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43,250,634 (GRCm39) missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43,242,614 (GRCm39) start gained probably benign
R5251:Arhgef5 UTSW 6 43,249,815 (GRCm39) missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43,249,273 (GRCm39) missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43,250,997 (GRCm39) missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43,252,874 (GRCm39) missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43,252,038 (GRCm39) missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43,252,068 (GRCm39) missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43,251,966 (GRCm39) missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43,251,895 (GRCm39) missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43,257,933 (GRCm39) missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43,250,232 (GRCm39) missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43,251,351 (GRCm39) missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43,252,276 (GRCm39) missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43,265,665 (GRCm39) missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43,252,142 (GRCm39) missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43,250,166 (GRCm39) nonsense probably null
R7358:Arhgef5 UTSW 6 43,256,507 (GRCm39) missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43,257,216 (GRCm39) missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43,257,605 (GRCm39) nonsense probably null
R7503:Arhgef5 UTSW 6 43,250,933 (GRCm39) missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43,250,728 (GRCm39) missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43,252,069 (GRCm39) nonsense probably null
R7950:Arhgef5 UTSW 6 43,250,859 (GRCm39) missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43,260,885 (GRCm39) missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43,257,579 (GRCm39) missense probably damaging 1.00
R8857:Arhgef5 UTSW 6 43,264,558 (GRCm39) missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43,260,940 (GRCm39) missense
R9610:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43,251,736 (GRCm39) missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43,250,527 (GRCm39) missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43,256,407 (GRCm39) missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43,250,635 (GRCm39) missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43,249,342 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACTGGGCTTTAGAATACCTTTGG -3'
(R):5'- TGACACAGCAGGCAGAACTG -3'

Sequencing Primer
(F):5'- AATACCTTTGGAATCATTGTCTTCTC -3'
(R):5'- AACTGGGTAGGTACAAACACC -3'
Posted On 2020-07-28