Mutagenetix > Incidental Mutation

Incidental Mutation 'R8318:Arhgef5'

641805

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

067855-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8318 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 43275999 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably null
Transcript: ENSMUST00000031750

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182924

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank1	T	C	8: 23,115,551	V1145A	probably damaging	Het
Ankrd35	G	A	3: 96,684,722	V775M	probably damaging	Het
Ankrd63	C	T	2: 118,703,240	V67M	unknown	Het
Atp13a2	A	T	4: 141,007,024	Q1152H	probably benign	Het
Carmil1	A	G	13: 24,036,459	L1094P	probably benign	Het
Col7a1	G	A	9: 108,958,374	A612T	unknown	Het
Csgalnact1	T	C	8: 68,461,133	E140G	probably damaging	Het
Ddx18	G	T	1: 121,566,087	A56D	probably benign	Het
Dixdc1	T	C	9: 50,684,409		probably null	Het
Dpys	G	A	15: 39,784,665	T498I	probably benign	Het
Ear6	A	G	14: 51,854,265	I90V	probably benign	Het
Egr1	T	C	18: 34,863,610	S482P	probably damaging	Het
Ehbp1	C	T	11: 22,137,980	R393Q	probably benign	Het
Enpep	A	G	3: 129,270,337	I927T	probably damaging	Het
Ermard	C	T	17: 15,022,072	T406I	possibly damaging	Het
Etl4	T	C	2: 20,788,530	S971P	probably damaging	Het
Fan1	C	A	7: 64,350,055	V861F	probably damaging	Het
Fbp1	A	G	13: 62,865,011	F328L	probably benign	Het
Fgd5	T	A	6: 91,987,496	F237I	probably benign	Het
Fmn1	T	C	2: 113,365,157	S401P	unknown	Het
Gabbr1	G	A	17: 37,062,543	E444K	probably benign	Het
Htr3b	C	A	9: 48,964,877		probably benign	Het
Ighv1-49	A	G	12: 115,055,431	F48S	probably damaging	Het
Kcnh4	A	G	11: 100,752,328	L371P	probably damaging	Het
Kcnk15	A	G	2: 163,858,269	T143A	probably damaging	Het
Klk1b4	T	G	7: 44,210,911	S150A	possibly damaging	Het
Krt6a	A	T	15: 101,694,247	M1K	probably null	Het
Lama2	G	A	10: 26,984,338	S3051L	probably damaging	Het
Lgals4	T	C	7: 28,834,515	M38T	probably benign	Het
Mdn1	T	C	4: 32,735,897		probably null	Het
Mindy1	A	G	3: 95,292,625	S246G	probably damaging	Het
Myo18a	A	G	11: 77,823,389	T770A	probably benign	Het
Olfr1221	T	A	2: 89,111,898	I205F	probably benign	Het
Olfr1254	C	T	2: 89,788,977	C125Y	possibly damaging	Het
Olfr270	T	C	4: 52,971,104	V161A	probably benign	Het
Pcdhb19	T	A	18: 37,497,946	S265T	possibly damaging	Het
Pcna	T	C	2: 132,251,428	Y133C	probably damaging	Het
Polr2b	A	G	5: 77,335,729	E684G	probably benign	Het
Pon2	T	C	6: 5,265,425	I321V	probably benign	Het
Prss54	T	A	8: 95,564,466	M169L	probably damaging	Het
Rps3	T	A	7: 99,483,731		probably benign	Het
Senp1	T	C	15: 98,064,867	D312G	probably damaging	Het
Serpina10	T	A	12: 103,616,848	T446S	possibly damaging	Het
Slc2a5	A	G	4: 150,139,658	D241G	possibly damaging	Het
Slc7a11	A	G	3: 50,417,986		probably null	Het
Tgfbrap1	G	C	1: 43,056,669	C536W	probably damaging	Het
Trip11	C	T	12: 101,912,804	G9S	unknown	Het
Zfp626	C	A	7: 27,818,245	T217K	possibly damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TACTGGGCTTTAGAATACCTTTGG -3'
(R):5'- TGACACAGCAGGCAGAACTG -3'

Sequencing Primer
(F):5'- AATACCTTTGGAATCATTGTCTTCTC -3'
(R):5'- AACTGGGTAGGTACAAACACC -3'

Posted On

2020-07-28