Incidental Mutation 'R8318:Fgd5'
ID 641806
Institutional Source Beutler Lab
Gene Symbol Fgd5
Ensembl Gene ENSMUSG00000034037
Gene Name FYVE, RhoGEF and PH domain containing 5
Synonyms C330025N11Rik, ZFYVE23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock # R8318 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 91978878-92076004 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 91987496 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 237 (F237I)
Ref Sequence ENSEMBL: ENSMUSP00000086748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089334] [ENSMUST00000113466]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000089334
AA Change: F237I

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000086748
Gene: ENSMUSG00000034037
AA Change: F237I

DomainStartEndE-ValueType
low complexity region 7 16 N/A INTRINSIC
internal_repeat_1 126 169 2.6e-7 PROSPERO
internal_repeat_1 164 198 2.6e-7 PROSPERO
low complexity region 201 222 N/A INTRINSIC
low complexity region 254 269 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 426 442 N/A INTRINSIC
low complexity region 453 475 N/A INTRINSIC
low complexity region 652 663 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
low complexity region 727 736 N/A INTRINSIC
low complexity region 879 894 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Pfam:RhoGEF 946 1134 2.2e-28 PFAM
PH 1165 1260 4.93e-13 SMART
FYVE 1285 1353 2.51e-16 SMART
low complexity region 1368 1390 N/A INTRINSIC
PH 1416 1514 2.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113466
AA Change: F79I

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109093
Gene: ENSMUSG00000034037
AA Change: F79I

DomainStartEndE-ValueType
low complexity region 43 64 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 295 317 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 537 547 N/A INTRINSIC
low complexity region 569 578 N/A INTRINSIC
low complexity region 721 736 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
Pfam:RhoGEF 788 976 1.6e-27 PFAM
PH 1007 1102 4.93e-13 SMART
FYVE 1127 1195 2.51e-16 SMART
low complexity region 1210 1232 N/A INTRINSIC
PH 1258 1356 2.77e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 T C 8: 23,115,551 V1145A probably damaging Het
Ankrd35 G A 3: 96,684,722 V775M probably damaging Het
Ankrd63 C T 2: 118,703,240 V67M unknown Het
Arhgef5 T A 6: 43,275,999 probably null Het
Atp13a2 A T 4: 141,007,024 Q1152H probably benign Het
Col7a1 G A 9: 108,958,374 A612T unknown Het
Csgalnact1 T C 8: 68,461,133 E140G probably damaging Het
Ddx18 G T 1: 121,566,087 A56D probably benign Het
Dixdc1 T C 9: 50,684,409 probably null Het
Dpys G A 15: 39,784,665 T498I probably benign Het
Ear6 A G 14: 51,854,265 I90V probably benign Het
Egr1 T C 18: 34,863,610 S482P probably damaging Het
Ehbp1 C T 11: 22,137,980 R393Q probably benign Het
Enpep A G 3: 129,270,337 I927T probably damaging Het
Ermard C T 17: 15,022,072 T406I possibly damaging Het
Etl4 T C 2: 20,788,530 S971P probably damaging Het
Fam63a A G 3: 95,292,625 S246G probably damaging Het
Fan1 C A 7: 64,350,055 V861F probably damaging Het
Fbp1 A G 13: 62,865,011 F328L probably benign Het
Fmn1 T C 2: 113,365,157 S401P unknown Het
Gabbr1 G A 17: 37,062,543 E444K probably benign Het
Htr3b C A 9: 48,964,877 probably benign Het
Ighv1-49 A G 12: 115,055,431 F48S probably damaging Het
Kcnh4 A G 11: 100,752,328 L371P probably damaging Het
Kcnk15 A G 2: 163,858,269 T143A probably damaging Het
Klk1b4 T G 7: 44,210,911 S150A possibly damaging Het
Krt6a A T 15: 101,694,247 M1K probably null Het
Lama2 G A 10: 26,984,338 S3051L probably damaging Het
Lgals4 T C 7: 28,834,515 M38T probably benign Het
Lrrc16a A G 13: 24,036,459 L1094P probably benign Het
Mdn1 T C 4: 32,735,897 probably null Het
Myo18a A G 11: 77,823,389 T770A probably benign Het
Olfr1221 T A 2: 89,111,898 I205F probably benign Het
Olfr1254 C T 2: 89,788,977 C125Y possibly damaging Het
Olfr270 T C 4: 52,971,104 V161A probably benign Het
Pcdhb19 T A 18: 37,497,946 S265T possibly damaging Het
Pcna T C 2: 132,251,428 Y133C probably damaging Het
Polr2b A G 5: 77,335,729 E684G probably benign Het
Pon2 T C 6: 5,265,425 I321V probably benign Het
Prss54 T A 8: 95,564,466 M169L probably damaging Het
Rps3 T A 7: 99,483,731 probably benign Het
Senp1 T C 15: 98,064,867 D312G probably damaging Het
Serpina10 T A 12: 103,616,848 T446S possibly damaging Het
Slc2a5 A G 4: 150,139,658 D241G possibly damaging Het
Slc7a11 A G 3: 50,417,986 probably null Het
Tgfbrap1 G C 1: 43,056,669 C536W probably damaging Het
Trip11 C T 12: 101,912,804 G9S unknown Het
Zfp626 C A 7: 27,818,245 T217K possibly damaging Het
Other mutations in Fgd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Fgd5 APN 6 91988459 missense possibly damaging 0.63
IGL01354:Fgd5 APN 6 92061843 nonsense probably null
IGL01597:Fgd5 APN 6 91987929 missense probably damaging 1.00
IGL01648:Fgd5 APN 6 91989359 nonsense probably null
IGL01781:Fgd5 APN 6 91988717 missense possibly damaging 0.88
IGL01977:Fgd5 APN 6 92024562 missense probably benign 0.20
IGL02053:Fgd5 APN 6 92053244 missense probably benign 0.03
IGL02206:Fgd5 APN 6 91987258 utr 5 prime probably benign
IGL02825:Fgd5 APN 6 92038087 splice site probably null
IGL02838:Fgd5 APN 6 91987674 missense probably benign
IGL03126:Fgd5 APN 6 92065164 missense probably damaging 1.00
IGL03369:Fgd5 APN 6 91988415 missense probably damaging 1.00
hygeia UTSW 6 91989300 missense probably damaging 1.00
Imploded UTSW 6 92049931 splice site probably null
R0029:Fgd5 UTSW 6 92067558 missense probably benign 0.04
R0109:Fgd5 UTSW 6 91988235 missense possibly damaging 0.74
R0109:Fgd5 UTSW 6 91988235 missense possibly damaging 0.74
R0212:Fgd5 UTSW 6 91988208 missense probably damaging 1.00
R1148:Fgd5 UTSW 6 91987631 missense probably benign
R1148:Fgd5 UTSW 6 91987631 missense probably benign
R1159:Fgd5 UTSW 6 91988502 missense probably benign 0.00
R1199:Fgd5 UTSW 6 91986978 missense possibly damaging 0.87
R1493:Fgd5 UTSW 6 91987631 missense probably benign
R1602:Fgd5 UTSW 6 92066184 missense possibly damaging 0.95
R1953:Fgd5 UTSW 6 92024630 missense probably benign 0.31
R2280:Fgd5 UTSW 6 91988945 missense possibly damaging 0.86
R2437:Fgd5 UTSW 6 92062869 nonsense probably null
R2883:Fgd5 UTSW 6 91987109 splice site probably null
R4133:Fgd5 UTSW 6 92069437 missense probably damaging 1.00
R4454:Fgd5 UTSW 6 91989186 missense probably damaging 1.00
R4491:Fgd5 UTSW 6 91989299 missense possibly damaging 0.90
R4606:Fgd5 UTSW 6 91988209 missense possibly damaging 0.67
R4981:Fgd5 UTSW 6 91989300 missense probably damaging 1.00
R5162:Fgd5 UTSW 6 92074234 missense probably damaging 1.00
R5525:Fgd5 UTSW 6 92066247 missense probably damaging 1.00
R5570:Fgd5 UTSW 6 91988687 missense probably damaging 1.00
R5936:Fgd5 UTSW 6 91987911 missense probably damaging 0.98
R6012:Fgd5 UTSW 6 91989341 missense possibly damaging 0.95
R6723:Fgd5 UTSW 6 91988030 missense probably benign
R6764:Fgd5 UTSW 6 91989421 missense probably damaging 0.96
R7187:Fgd5 UTSW 6 91988291 missense possibly damaging 0.54
R7383:Fgd5 UTSW 6 91987118 missense probably benign 0.01
R7418:Fgd5 UTSW 6 92024538 missense probably benign 0.11
R7662:Fgd5 UTSW 6 92049931 splice site probably null
R7788:Fgd5 UTSW 6 91988459 missense possibly damaging 0.63
R7882:Fgd5 UTSW 6 92068478 missense probably damaging 1.00
R7895:Fgd5 UTSW 6 91987281 missense probably benign 0.03
R8041:Fgd5 UTSW 6 92061856 missense probably damaging 0.98
R8053:Fgd5 UTSW 6 91989444 missense probably benign 0.34
R8176:Fgd5 UTSW 6 91987984 missense probably benign 0.13
R8243:Fgd5 UTSW 6 91989023 missense possibly damaging 0.93
R8772:Fgd5 UTSW 6 92050419 missense probably damaging 0.99
R8804:Fgd5 UTSW 6 91987526 missense probably benign
R9036:Fgd5 UTSW 6 92069466 nonsense probably null
R9041:Fgd5 UTSW 6 91987446 missense probably benign 0.15
R9173:Fgd5 UTSW 6 92067603 critical splice donor site probably null
R9206:Fgd5 UTSW 6 92038210 missense probably damaging 1.00
R9424:Fgd5 UTSW 6 91979036 nonsense probably null
R9437:Fgd5 UTSW 6 91987646 missense probably benign 0.07
R9715:Fgd5 UTSW 6 91988309 missense possibly damaging 0.91
R9721:Fgd5 UTSW 6 91988297 missense probably benign 0.09
X0064:Fgd5 UTSW 6 92050040 missense probably benign 0.02
Z1176:Fgd5 UTSW 6 91988889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGATCACGATCCAGAGACGG -3'
(R):5'- TCTTGCTCCTGGACATCTGG -3'

Sequencing Primer
(F):5'- TCCAGAGACGGATGGGACC -3'
(R):5'- ATCTGGGGACACCTCACTC -3'
Posted On 2020-07-28