Mutagenetix > Incidental Mutation

Incidental Mutation 'R8318:Fgd5'

641806

Institutional Source

Beutler Lab

Gene Symbol

Fgd5

Ensembl Gene

ENSMUSG00000034037

Gene Name

FYVE, RhoGEF and PH domain containing 5

Synonyms

C330025N11Rik, ZFYVE23

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.239) question?

Stock #

R8318 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

91978878-92076004 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 91987496 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 237 (F237I)

Ref Sequence

ENSEMBL: ENSMUSP00000086748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089334] [ENSMUST00000113466]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000089334
AA Change: F237I

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000086748
Gene: ENSMUSG00000034037
AA Change: F237I

Domain	Start	End	E-Value	Type
low complexity region	7	16	N/A	INTRINSIC
internal_repeat_1	126	169	2.6e-7	PROSPERO
internal_repeat_1	164	198	2.6e-7	PROSPERO
low complexity region	201	222	N/A	INTRINSIC
low complexity region	254	269	N/A	INTRINSIC
low complexity region	321	332	N/A	INTRINSIC
low complexity region	426	442	N/A	INTRINSIC
low complexity region	453	475	N/A	INTRINSIC
low complexity region	652	663	N/A	INTRINSIC
low complexity region	695	705	N/A	INTRINSIC
low complexity region	727	736	N/A	INTRINSIC
low complexity region	879	894	N/A	INTRINSIC
low complexity region	914	928	N/A	INTRINSIC
Pfam:RhoGEF	946	1134	2.2e-28	PFAM
PH	1165	1260	4.93e-13	SMART
FYVE	1285	1353	2.51e-16	SMART
low complexity region	1368	1390	N/A	INTRINSIC
PH	1416	1514	2.77e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113466
AA Change: F79I

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000109093
Gene: ENSMUSG00000034037
AA Change: F79I

Domain	Start	End	E-Value	Type
low complexity region	43	64	N/A	INTRINSIC
low complexity region	96	111	N/A	INTRINSIC
low complexity region	163	174	N/A	INTRINSIC
low complexity region	268	284	N/A	INTRINSIC
low complexity region	295	317	N/A	INTRINSIC
low complexity region	494	505	N/A	INTRINSIC
low complexity region	537	547	N/A	INTRINSIC
low complexity region	569	578	N/A	INTRINSIC
low complexity region	721	736	N/A	INTRINSIC
low complexity region	756	770	N/A	INTRINSIC
Pfam:RhoGEF	788	976	1.6e-27	PFAM
PH	1007	1102	4.93e-13	SMART
FYVE	1127	1195	2.51e-16	SMART
low complexity region	1210	1232	N/A	INTRINSIC
PH	1258	1356	2.77e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ank1	T	C	8: 23,115,551	V1145A	probably damaging	Het
Ankrd35	G	A	3: 96,684,722	V775M	probably damaging	Het
Ankrd63	C	T	2: 118,703,240	V67M	unknown	Het
Arhgef5	T	A	6: 43,275,999		probably null	Het
Atp13a2	A	T	4: 141,007,024	Q1152H	probably benign	Het
Col7a1	G	A	9: 108,958,374	A612T	unknown	Het
Csgalnact1	T	C	8: 68,461,133	E140G	probably damaging	Het
Ddx18	G	T	1: 121,566,087	A56D	probably benign	Het
Dixdc1	T	C	9: 50,684,409		probably null	Het
Dpys	G	A	15: 39,784,665	T498I	probably benign	Het
Ear6	A	G	14: 51,854,265	I90V	probably benign	Het
Egr1	T	C	18: 34,863,610	S482P	probably damaging	Het
Ehbp1	C	T	11: 22,137,980	R393Q	probably benign	Het
Enpep	A	G	3: 129,270,337	I927T	probably damaging	Het
Ermard	C	T	17: 15,022,072	T406I	possibly damaging	Het
Etl4	T	C	2: 20,788,530	S971P	probably damaging	Het
Fam63a	A	G	3: 95,292,625	S246G	probably damaging	Het
Fan1	C	A	7: 64,350,055	V861F	probably damaging	Het
Fbp1	A	G	13: 62,865,011	F328L	probably benign	Het
Fmn1	T	C	2: 113,365,157	S401P	unknown	Het
Gabbr1	G	A	17: 37,062,543	E444K	probably benign	Het
Htr3b	C	A	9: 48,964,877		probably benign	Het
Ighv1-49	A	G	12: 115,055,431	F48S	probably damaging	Het
Kcnh4	A	G	11: 100,752,328	L371P	probably damaging	Het
Kcnk15	A	G	2: 163,858,269	T143A	probably damaging	Het
Klk1b4	T	G	7: 44,210,911	S150A	possibly damaging	Het
Krt6a	A	T	15: 101,694,247	M1K	probably null	Het
Lama2	G	A	10: 26,984,338	S3051L	probably damaging	Het
Lgals4	T	C	7: 28,834,515	M38T	probably benign	Het
Lrrc16a	A	G	13: 24,036,459	L1094P	probably benign	Het
Mdn1	T	C	4: 32,735,897		probably null	Het
Myo18a	A	G	11: 77,823,389	T770A	probably benign	Het
Olfr1221	T	A	2: 89,111,898	I205F	probably benign	Het
Olfr1254	C	T	2: 89,788,977	C125Y	possibly damaging	Het
Olfr270	T	C	4: 52,971,104	V161A	probably benign	Het
Pcdhb19	T	A	18: 37,497,946	S265T	possibly damaging	Het
Pcna	T	C	2: 132,251,428	Y133C	probably damaging	Het
Polr2b	A	G	5: 77,335,729	E684G	probably benign	Het
Pon2	T	C	6: 5,265,425	I321V	probably benign	Het
Prss54	T	A	8: 95,564,466	M169L	probably damaging	Het
Rps3	T	A	7: 99,483,731		probably benign	Het
Senp1	T	C	15: 98,064,867	D312G	probably damaging	Het
Serpina10	T	A	12: 103,616,848	T446S	possibly damaging	Het
Slc2a5	A	G	4: 150,139,658	D241G	possibly damaging	Het
Slc7a11	A	G	3: 50,417,986		probably null	Het
Tgfbrap1	G	C	1: 43,056,669	C536W	probably damaging	Het
Trip11	C	T	12: 101,912,804	G9S	unknown	Het
Zfp626	C	A	7: 27,818,245	T217K	possibly damaging	Het

Other mutations in Fgd5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00823:Fgd5	APN	6	91988459	missense	possibly damaging	0.63
IGL01354:Fgd5	APN	6	92061843	nonsense	probably null
IGL01597:Fgd5	APN	6	91987929	missense	probably damaging	1.00
IGL01648:Fgd5	APN	6	91989359	nonsense	probably null
IGL01781:Fgd5	APN	6	91988717	missense	possibly damaging	0.88
IGL01977:Fgd5	APN	6	92024562	missense	probably benign	0.20
IGL02053:Fgd5	APN	6	92053244	missense	probably benign	0.03
IGL02206:Fgd5	APN	6	91987258	utr 5 prime	probably benign
IGL02825:Fgd5	APN	6	92038087	splice site	probably null
IGL02838:Fgd5	APN	6	91987674	missense	probably benign
IGL03126:Fgd5	APN	6	92065164	missense	probably damaging	1.00
IGL03369:Fgd5	APN	6	91988415	missense	probably damaging	1.00
hygeia	UTSW	6	91989300	missense	probably damaging	1.00
Imploded	UTSW	6	92049931	splice site	probably null
R0029:Fgd5	UTSW	6	92067558	missense	probably benign	0.04
R0109:Fgd5	UTSW	6	91988235	missense	possibly damaging	0.74
R0109:Fgd5	UTSW	6	91988235	missense	possibly damaging	0.74
R0212:Fgd5	UTSW	6	91988208	missense	probably damaging	1.00
R1148:Fgd5	UTSW	6	91987631	missense	probably benign
R1148:Fgd5	UTSW	6	91987631	missense	probably benign
R1159:Fgd5	UTSW	6	91988502	missense	probably benign	0.00
R1199:Fgd5	UTSW	6	91986978	missense	possibly damaging	0.87
R1493:Fgd5	UTSW	6	91987631	missense	probably benign
R1602:Fgd5	UTSW	6	92066184	missense	possibly damaging	0.95
R1953:Fgd5	UTSW	6	92024630	missense	probably benign	0.31
R2280:Fgd5	UTSW	6	91988945	missense	possibly damaging	0.86
R2437:Fgd5	UTSW	6	92062869	nonsense	probably null
R2883:Fgd5	UTSW	6	91987109	splice site	probably null
R4133:Fgd5	UTSW	6	92069437	missense	probably damaging	1.00
R4454:Fgd5	UTSW	6	91989186	missense	probably damaging	1.00
R4491:Fgd5	UTSW	6	91989299	missense	possibly damaging	0.90
R4606:Fgd5	UTSW	6	91988209	missense	possibly damaging	0.67
R4981:Fgd5	UTSW	6	91989300	missense	probably damaging	1.00
R5162:Fgd5	UTSW	6	92074234	missense	probably damaging	1.00
R5525:Fgd5	UTSW	6	92066247	missense	probably damaging	1.00
R5570:Fgd5	UTSW	6	91988687	missense	probably damaging	1.00
R5936:Fgd5	UTSW	6	91987911	missense	probably damaging	0.98
R6012:Fgd5	UTSW	6	91989341	missense	possibly damaging	0.95
R6723:Fgd5	UTSW	6	91988030	missense	probably benign
R6764:Fgd5	UTSW	6	91989421	missense	probably damaging	0.96
R7187:Fgd5	UTSW	6	91988291	missense	possibly damaging	0.54
R7383:Fgd5	UTSW	6	91987118	missense	probably benign	0.01
R7418:Fgd5	UTSW	6	92024538	missense	probably benign	0.11
R7662:Fgd5	UTSW	6	92049931	splice site	probably null
R7788:Fgd5	UTSW	6	91988459	missense	possibly damaging	0.63
R7882:Fgd5	UTSW	6	92068478	missense	probably damaging	1.00
R7895:Fgd5	UTSW	6	91987281	missense	probably benign	0.03
R8041:Fgd5	UTSW	6	92061856	missense	probably damaging	0.98
R8053:Fgd5	UTSW	6	91989444	missense	probably benign	0.34
R8176:Fgd5	UTSW	6	91987984	missense	probably benign	0.13
R8243:Fgd5	UTSW	6	91989023	missense	possibly damaging	0.93
R8772:Fgd5	UTSW	6	92050419	missense	probably damaging	0.99
R8804:Fgd5	UTSW	6	91987526	missense	probably benign
R9036:Fgd5	UTSW	6	92069466	nonsense	probably null
R9041:Fgd5	UTSW	6	91987446	missense	probably benign	0.15
R9173:Fgd5	UTSW	6	92067603	critical splice donor site	probably null
R9206:Fgd5	UTSW	6	92038210	missense	probably damaging	1.00
R9424:Fgd5	UTSW	6	91979036	nonsense	probably null
R9437:Fgd5	UTSW	6	91987646	missense	probably benign	0.07
R9715:Fgd5	UTSW	6	91988309	missense	possibly damaging	0.91
R9721:Fgd5	UTSW	6	91988297	missense	probably benign	0.09
X0064:Fgd5	UTSW	6	92050040	missense	probably benign	0.02
Z1176:Fgd5	UTSW	6	91988889	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGATCACGATCCAGAGACGG -3'
(R):5'- TCTTGCTCCTGGACATCTGG -3'

Sequencing Primer
(F):5'- TCCAGAGACGGATGGGACC -3'
(R):5'- ATCTGGGGACACCTCACTC -3'

Posted On

2020-07-28