Incidental Mutation 'R8318:Col7a1'
ID 641817
Institutional Source Beutler Lab
Gene Symbol Col7a1
Ensembl Gene ENSMUSG00000025650
Gene Name collagen, type VII, alpha 1
Synonyms
MMRRC Submission 067855-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8318 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108782654-108813943 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 108787442 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 612 (A612T)
Ref Sequence ENSEMBL: ENSMUSP00000026740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026740] [ENSMUST00000112070]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000026740
AA Change: A612T
SMART Domains Protein: ENSMUSP00000026740
Gene: ENSMUSG00000025650
AA Change: A612T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1227 2.3e-22 PFAM
Pfam:Collagen 1244 1311 2.4e-8 PFAM
Pfam:Collagen 1294 1355 4.1e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.8e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.4e-9 PFAM
Pfam:Collagen 2025 2092 9.1e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.5e-8 PFAM
Pfam:Collagen 2364 2423 7.3e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.4e-11 PFAM
Pfam:Collagen 2516 2572 1.9e-9 PFAM
Pfam:Collagen 2560 2630 7.2e-9 PFAM
Pfam:Collagen 2605 2682 6e-9 PFAM
Pfam:Collagen 2659 2722 2e-8 PFAM
low complexity region 2745 2775 N/A INTRINSIC
Pfam:Kunitz_BPTI 2878 2932 3.2e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112070
AA Change: A612T
SMART Domains Protein: ENSMUSP00000107701
Gene: ENSMUSG00000025650
AA Change: A612T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1230 2.2e-19 PFAM
Pfam:Collagen 1244 1311 2.5e-8 PFAM
Pfam:Collagen 1294 1355 4.2e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5.1e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.9e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.5e-9 PFAM
Pfam:Collagen 2025 2092 9.4e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2195 2266 7.7e-7 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.6e-8 PFAM
Pfam:Collagen 2364 2423 7.6e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.7e-11 PFAM
Pfam:Collagen 2516 2572 2e-9 PFAM
Pfam:Collagen 2560 2630 7.4e-9 PFAM
Pfam:Collagen 2605 2682 6.2e-9 PFAM
Pfam:Collagen 2659 2722 2.1e-8 PFAM
Pfam:Collagen 2719 2778 1.6e-7 PFAM
Pfam:Kunitz_BPTI 2878 2932 1.1e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 T C 8: 23,605,567 (GRCm39) V1145A probably damaging Het
Ankrd35 G A 3: 96,592,038 (GRCm39) V775M probably damaging Het
Ankrd63 C T 2: 118,533,721 (GRCm39) V67M unknown Het
Arhgef5 T A 6: 43,252,933 (GRCm39) probably null Het
Atp13a2 A T 4: 140,734,335 (GRCm39) Q1152H probably benign Het
Carmil1 A G 13: 24,220,442 (GRCm39) L1094P probably benign Het
Csgalnact1 T C 8: 68,913,785 (GRCm39) E140G probably damaging Het
Ddx18 G T 1: 121,493,816 (GRCm39) A56D probably benign Het
Dixdc1 T C 9: 50,595,709 (GRCm39) probably null Het
Dpys G A 15: 39,648,061 (GRCm39) T498I probably benign Het
Ear6 A G 14: 52,091,722 (GRCm39) I90V probably benign Het
Egr1 T C 18: 34,996,663 (GRCm39) S482P probably damaging Het
Ehbp1 C T 11: 22,087,980 (GRCm39) R393Q probably benign Het
Enpep A G 3: 129,063,986 (GRCm39) I927T probably damaging Het
Ermard C T 17: 15,242,334 (GRCm39) T406I possibly damaging Het
Etl4 T C 2: 20,793,341 (GRCm39) S971P probably damaging Het
Fan1 C A 7: 63,999,803 (GRCm39) V861F probably damaging Het
Fbp1 A G 13: 63,012,825 (GRCm39) F328L probably benign Het
Fgd5 T A 6: 91,964,477 (GRCm39) F237I probably benign Het
Fmn1 T C 2: 113,195,502 (GRCm39) S401P unknown Het
Gabbr1 G A 17: 37,373,435 (GRCm39) E444K probably benign Het
Htr3b C A 9: 48,876,177 (GRCm39) probably benign Het
Ighv1-49 A G 12: 115,019,051 (GRCm39) F48S probably damaging Het
Kcnh4 A G 11: 100,643,154 (GRCm39) L371P probably damaging Het
Kcnk15 A G 2: 163,700,189 (GRCm39) T143A probably damaging Het
Klk1b4 T G 7: 43,860,335 (GRCm39) S150A possibly damaging Het
Krt6a A T 15: 101,602,682 (GRCm39) M1K probably null Het
Lama2 G A 10: 26,860,334 (GRCm39) S3051L probably damaging Het
Lgals4 T C 7: 28,533,940 (GRCm39) M38T probably benign Het
Mdn1 T C 4: 32,735,897 (GRCm39) probably null Het
Mindy1 A G 3: 95,199,936 (GRCm39) S246G probably damaging Het
Myo18a A G 11: 77,714,215 (GRCm39) T770A probably benign Het
Or13d1 T C 4: 52,971,104 (GRCm39) V161A probably benign Het
Or4a81 C T 2: 89,619,321 (GRCm39) C125Y possibly damaging Het
Or4c116 T A 2: 88,942,242 (GRCm39) I205F probably benign Het
Pcdhb19 T A 18: 37,630,999 (GRCm39) S265T possibly damaging Het
Pcna T C 2: 132,093,348 (GRCm39) Y133C probably damaging Het
Polr2b A G 5: 77,483,576 (GRCm39) E684G probably benign Het
Pon2 T C 6: 5,265,425 (GRCm39) I321V probably benign Het
Prss54 T A 8: 96,291,094 (GRCm39) M169L probably damaging Het
Rps3 T A 7: 99,132,938 (GRCm39) probably benign Het
Senp1 T C 15: 97,962,748 (GRCm39) D312G probably damaging Het
Serpina10 T A 12: 103,583,107 (GRCm39) T446S possibly damaging Het
Slc2a5 A G 4: 150,224,115 (GRCm39) D241G possibly damaging Het
Slc7a11 A G 3: 50,372,435 (GRCm39) probably null Het
Tgfbrap1 G C 1: 43,095,829 (GRCm39) C536W probably damaging Het
Trip11 C T 12: 101,879,063 (GRCm39) G9S unknown Het
Zfp626 C A 7: 27,517,670 (GRCm39) T217K possibly damaging Het
Other mutations in Col7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Col7a1 APN 9 108,806,765 (GRCm39) nonsense probably null
IGL01366:Col7a1 APN 9 108,806,187 (GRCm39) splice site probably benign
IGL01395:Col7a1 APN 9 108,812,980 (GRCm39) unclassified probably benign
IGL01410:Col7a1 APN 9 108,793,686 (GRCm39) missense unknown
IGL01902:Col7a1 APN 9 108,806,895 (GRCm39) missense unknown
IGL01915:Col7a1 APN 9 108,784,813 (GRCm39) missense unknown
IGL01936:Col7a1 APN 9 108,797,067 (GRCm39) splice site probably benign
IGL01943:Col7a1 APN 9 108,813,084 (GRCm39) critical splice acceptor site probably null
IGL02026:Col7a1 APN 9 108,797,097 (GRCm39) missense probably damaging 1.00
IGL02168:Col7a1 APN 9 108,813,143 (GRCm39) unclassified probably benign
IGL02504:Col7a1 APN 9 108,809,743 (GRCm39) missense unknown
IGL02510:Col7a1 APN 9 108,802,299 (GRCm39) splice site probably benign
IGL02559:Col7a1 APN 9 108,802,284 (GRCm39) missense unknown
IGL02583:Col7a1 APN 9 108,791,297 (GRCm39) missense unknown
IGL02728:Col7a1 APN 9 108,813,172 (GRCm39) missense probably benign 0.39
IGL03003:Col7a1 APN 9 108,804,024 (GRCm39) critical splice donor site probably null
IGL03096:Col7a1 APN 9 108,784,856 (GRCm39) missense unknown
IGL03122:Col7a1 APN 9 108,790,751 (GRCm39) missense unknown
IGL03212:Col7a1 APN 9 108,803,520 (GRCm39) missense unknown
IGL03240:Col7a1 APN 9 108,797,441 (GRCm39) missense probably null 1.00
IGL03355:Col7a1 APN 9 108,807,228 (GRCm39) missense unknown
olivetti UTSW 9 108,799,029 (GRCm39) missense probably damaging 1.00
smallified UTSW 9 108,801,881 (GRCm39) critical splice donor site probably null
underwood UTSW 9 108,797,943 (GRCm39) critical splice acceptor site probably null
PIT4131001:Col7a1 UTSW 9 108,794,989 (GRCm39) splice site probably benign
R0007:Col7a1 UTSW 9 108,790,471 (GRCm39) missense unknown
R0007:Col7a1 UTSW 9 108,790,471 (GRCm39) missense unknown
R0078:Col7a1 UTSW 9 108,803,981 (GRCm39) splice site probably benign
R0091:Col7a1 UTSW 9 108,796,574 (GRCm39) splice site probably benign
R0126:Col7a1 UTSW 9 108,798,651 (GRCm39) splice site probably benign
R0244:Col7a1 UTSW 9 108,801,252 (GRCm39) splice site probably null
R0331:Col7a1 UTSW 9 108,796,570 (GRCm39) splice site probably benign
R0375:Col7a1 UTSW 9 108,809,305 (GRCm39) missense unknown
R0601:Col7a1 UTSW 9 108,809,652 (GRCm39) splice site probably benign
R0609:Col7a1 UTSW 9 108,787,215 (GRCm39) missense unknown
R0709:Col7a1 UTSW 9 108,790,616 (GRCm39) splice site probably benign
R0879:Col7a1 UTSW 9 108,805,159 (GRCm39) splice site probably benign
R1175:Col7a1 UTSW 9 108,784,402 (GRCm39) missense unknown
R1177:Col7a1 UTSW 9 108,791,509 (GRCm39) missense unknown
R1435:Col7a1 UTSW 9 108,792,341 (GRCm39) missense unknown
R1497:Col7a1 UTSW 9 108,807,893 (GRCm39) missense unknown
R1549:Col7a1 UTSW 9 108,785,034 (GRCm39) missense unknown
R1794:Col7a1 UTSW 9 108,794,996 (GRCm39) missense unknown
R1801:Col7a1 UTSW 9 108,790,065 (GRCm39) missense unknown
R1848:Col7a1 UTSW 9 108,798,633 (GRCm39) missense possibly damaging 0.83
R1899:Col7a1 UTSW 9 108,807,956 (GRCm39) missense unknown
R1944:Col7a1 UTSW 9 108,789,078 (GRCm39) missense unknown
R1945:Col7a1 UTSW 9 108,789,078 (GRCm39) missense unknown
R1955:Col7a1 UTSW 9 108,784,732 (GRCm39) missense unknown
R2009:Col7a1 UTSW 9 108,797,943 (GRCm39) critical splice acceptor site probably null
R2034:Col7a1 UTSW 9 108,792,075 (GRCm39) missense unknown
R3148:Col7a1 UTSW 9 108,790,473 (GRCm39) missense unknown
R3713:Col7a1 UTSW 9 108,793,508 (GRCm39) nonsense probably null
R4078:Col7a1 UTSW 9 108,790,059 (GRCm39) missense unknown
R4193:Col7a1 UTSW 9 108,785,740 (GRCm39) missense unknown
R4232:Col7a1 UTSW 9 108,801,881 (GRCm39) critical splice donor site probably null
R4528:Col7a1 UTSW 9 108,788,601 (GRCm39) missense unknown
R4771:Col7a1 UTSW 9 108,800,993 (GRCm39) missense probably damaging 0.99
R4820:Col7a1 UTSW 9 108,797,675 (GRCm39) missense possibly damaging 0.72
R4896:Col7a1 UTSW 9 108,786,345 (GRCm39) missense unknown
R4911:Col7a1 UTSW 9 108,804,287 (GRCm39) missense unknown
R4915:Col7a1 UTSW 9 108,795,532 (GRCm39) missense unknown
R4917:Col7a1 UTSW 9 108,795,532 (GRCm39) missense unknown
R5001:Col7a1 UTSW 9 108,794,146 (GRCm39) critical splice donor site probably null
R5352:Col7a1 UTSW 9 108,790,479 (GRCm39) missense unknown
R5361:Col7a1 UTSW 9 108,792,292 (GRCm39) missense unknown
R5730:Col7a1 UTSW 9 108,801,310 (GRCm39) critical splice donor site probably null
R5838:Col7a1 UTSW 9 108,807,211 (GRCm39) missense unknown
R5842:Col7a1 UTSW 9 108,794,883 (GRCm39) missense unknown
R5932:Col7a1 UTSW 9 108,809,279 (GRCm39) missense unknown
R6091:Col7a1 UTSW 9 108,784,402 (GRCm39) missense unknown
R6144:Col7a1 UTSW 9 108,803,148 (GRCm39) missense unknown
R6158:Col7a1 UTSW 9 108,793,671 (GRCm39) missense unknown
R6170:Col7a1 UTSW 9 108,795,511 (GRCm39) missense unknown
R6247:Col7a1 UTSW 9 108,810,130 (GRCm39) unclassified probably benign
R6338:Col7a1 UTSW 9 108,785,701 (GRCm39) missense unknown
R6339:Col7a1 UTSW 9 108,785,701 (GRCm39) missense unknown
R6382:Col7a1 UTSW 9 108,804,461 (GRCm39) missense unknown
R6518:Col7a1 UTSW 9 108,784,595 (GRCm39) missense unknown
R6533:Col7a1 UTSW 9 108,790,426 (GRCm39) missense unknown
R6569:Col7a1 UTSW 9 108,807,178 (GRCm39) splice site probably null
R6596:Col7a1 UTSW 9 108,783,409 (GRCm39) unclassified probably benign
R6697:Col7a1 UTSW 9 108,799,601 (GRCm39) missense probably damaging 1.00
R6753:Col7a1 UTSW 9 108,787,196 (GRCm39) missense unknown
R6849:Col7a1 UTSW 9 108,804,121 (GRCm39) missense unknown
R6915:Col7a1 UTSW 9 108,796,686 (GRCm39) missense probably benign 0.02
R6974:Col7a1 UTSW 9 108,798,494 (GRCm39) missense possibly damaging 0.82
R6991:Col7a1 UTSW 9 108,812,987 (GRCm39) critical splice donor site probably null
R7028:Col7a1 UTSW 9 108,792,331 (GRCm39) nonsense probably null
R7556:Col7a1 UTSW 9 108,811,533 (GRCm39) splice site probably null
R7571:Col7a1 UTSW 9 108,811,775 (GRCm39) missense probably null
R7815:Col7a1 UTSW 9 108,798,633 (GRCm39) missense probably damaging 0.96
R7875:Col7a1 UTSW 9 108,787,763 (GRCm39) missense unknown
R7931:Col7a1 UTSW 9 108,809,590 (GRCm39) splice site probably benign
R8016:Col7a1 UTSW 9 108,787,712 (GRCm39) missense unknown
R8038:Col7a1 UTSW 9 108,786,360 (GRCm39) missense unknown
R8049:Col7a1 UTSW 9 108,804,631 (GRCm39) missense unknown
R8098:Col7a1 UTSW 9 108,785,763 (GRCm39) missense unknown
R8103:Col7a1 UTSW 9 108,804,452 (GRCm39) missense unknown
R8128:Col7a1 UTSW 9 108,784,789 (GRCm39) missense unknown
R8268:Col7a1 UTSW 9 108,802,057 (GRCm39) missense unknown
R8274:Col7a1 UTSW 9 108,799,029 (GRCm39) missense probably damaging 1.00
R8751:Col7a1 UTSW 9 108,796,730 (GRCm39) missense possibly damaging 0.92
R8824:Col7a1 UTSW 9 108,796,093 (GRCm39) missense unknown
R9148:Col7a1 UTSW 9 108,789,274 (GRCm39) missense unknown
R9170:Col7a1 UTSW 9 108,785,707 (GRCm39) missense unknown
R9171:Col7a1 UTSW 9 108,807,953 (GRCm39) missense unknown
R9236:Col7a1 UTSW 9 108,789,684 (GRCm39) missense unknown
R9287:Col7a1 UTSW 9 108,787,457 (GRCm39) missense unknown
R9378:Col7a1 UTSW 9 108,787,708 (GRCm39) nonsense probably null
R9443:Col7a1 UTSW 9 108,785,059 (GRCm39) missense unknown
R9486:Col7a1 UTSW 9 108,811,396 (GRCm39) missense unknown
R9537:Col7a1 UTSW 9 108,784,420 (GRCm39) nonsense probably null
R9559:Col7a1 UTSW 9 108,786,360 (GRCm39) missense unknown
R9563:Col7a1 UTSW 9 108,791,809 (GRCm39) missense unknown
R9565:Col7a1 UTSW 9 108,791,809 (GRCm39) missense unknown
R9578:Col7a1 UTSW 9 108,789,350 (GRCm39) missense unknown
R9664:Col7a1 UTSW 9 108,812,649 (GRCm39) missense unknown
RF008:Col7a1 UTSW 9 108,793,547 (GRCm39) missense unknown
X0023:Col7a1 UTSW 9 108,813,253 (GRCm39) unclassified probably benign
Z1088:Col7a1 UTSW 9 108,807,568 (GRCm39) splice site silent
Z1177:Col7a1 UTSW 9 108,803,991 (GRCm39) missense unknown
Z1177:Col7a1 UTSW 9 108,813,145 (GRCm39) missense unknown
Z1177:Col7a1 UTSW 9 108,805,119 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGAGCCAGACAACCTTTGAC -3'
(R):5'- ATGTCCGTGACAGTGGAGTC -3'

Sequencing Primer
(F):5'- GAGCCAGACAACCTTTGACTTAGATG -3'
(R):5'- ACTCTGGACCTGGGATCAGAG -3'
Posted On 2020-07-28