Incidental Mutation 'R0109:Ppfia4'
ID64182
Institutional Source Beutler Lab
Gene Symbol Ppfia4
Ensembl Gene ENSMUSG00000026458
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms1110008G13Rik, LOC100042382, Liprin-alpha4, Gm3812
MMRRC Submission 038395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0109 (G1)
Quality Score167
Status Not validated
Chromosome1
Chromosomal Location134296783-134332928 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 134324217 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168515] [ENSMUST00000186730] [ENSMUST00000189361]
Predicted Effect probably null
Transcript: ENSMUST00000168515
SMART Domains Protein: ENSMUSP00000128314
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 1.17e-9 SMART
SAM 941 1008 1.69e-6 SMART
SAM 1029 1101 4.87e-7 SMART
low complexity region 1154 1167 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186730
SMART Domains Protein: ENSMUSP00000139800
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 1 191 N/A INTRINSIC
coiled coil region 284 328 N/A INTRINSIC
low complexity region 346 362 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
SAM 543 612 7e-12 SMART
SAM 649 716 1e-8 SMART
SAM 737 809 2.8e-9 SMART
low complexity region 862 875 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000189361
SMART Domains Protein: ENSMUSP00000139833
Gene: ENSMUSG00000026458

DomainStartEndE-ValueType
coiled coil region 22 127 N/A INTRINSIC
coiled coil region 225 474 N/A INTRINSIC
coiled coil region 567 611 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
SAM 826 895 7e-12 SMART
SAM 941 1008 1e-8 SMART
SAM 1029 1101 2.8e-9 SMART
low complexity region 1154 1167 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,318,762 K1496* probably null Het
Anapc1 C A 2: 128,634,693 R1335L probably damaging Het
Arhgef10l A T 4: 140,578,294 S203T probably benign Het
Astn1 C T 1: 158,664,104 T41I possibly damaging Het
Avil A G 10: 127,013,644 N603S probably benign Het
Brca1 T C 11: 101,531,090 D149G possibly damaging Het
Col19a1 A C 1: 24,559,768 probably null Het
Cps1 T C 1: 67,229,418 V1435A possibly damaging Het
Cyp2j6 A T 4: 96,518,157 I459N probably damaging Het
Cyth1 T C 11: 118,182,306 E242G probably damaging Het
Dclk3 T G 9: 111,467,670 L94R possibly damaging Het
Dsg3 T C 18: 20,540,134 V954A probably damaging Het
Dync2h1 T A 9: 7,111,487 D309V probably damaging Het
Efhd2 A G 4: 141,874,567 F101L probably benign Het
Fgd5 T A 6: 91,988,235 M325K possibly damaging Het
Fras1 T C 5: 96,710,077 S2077P probably benign Het
Frmpd1 A T 4: 45,279,340 E688D probably benign Het
Hspg2 T C 4: 137,562,201 V3824A probably benign Het
Kctd16 A G 18: 40,259,151 E264G probably benign Het
Mapk15 A T 15: 75,996,077 K153* probably null Het
Miox G A 15: 89,335,581 V91I probably benign Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Olfr1241 A G 2: 89,482,803 F111L probably benign Het
Olfr1442 C A 19: 12,674,860 F218L probably benign Het
Olfr646 T C 7: 104,106,605 S109P probably damaging Het
Parp9 T C 16: 35,948,341 I64T probably damaging Het
Pfkfb4 T C 9: 108,998,889 V43A probably benign Het
Pgap1 A T 1: 54,494,825 V643E probably damaging Het
Pip5k1b T A 19: 24,379,047 M176L probably benign Het
Prdx2 G A 8: 84,970,251 G4S probably benign Het
Rin3 A G 12: 102,313,081 I50V possibly damaging Het
Rtl1 G A 12: 109,595,407 probably benign Het
Sgsm3 G C 15: 81,009,466 D434H probably damaging Het
Shank2 T C 7: 144,410,577 S634P possibly damaging Het
Sik2 A G 9: 50,899,475 M447T possibly damaging Het
Sla2 A G 2: 156,883,587 probably null Het
Spata16 T A 3: 26,913,267 F389I probably damaging Het
Srebf1 G A 11: 60,201,804 A793V probably benign Het
Tmed11 T A 5: 108,777,412 D178V probably damaging Het
Traf7 A G 17: 24,513,926 F110L probably benign Het
Ttn T A 2: 76,725,564 I30366F probably damaging Het
Ubqlnl C T 7: 104,150,192 V33M probably damaging Het
Vmn1r194 A G 13: 22,245,047 Y278C probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r114 A T 17: 23,310,575 Y184* probably null Het
Vmn2r53 C T 7: 12,582,066 A609T probably damaging Het
Vps13b A G 15: 35,572,119 T961A probably benign Het
Xirp2 T A 2: 67,519,278 N3272K probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp454 T A 11: 50,883,775 T24S possibly damaging Het
Other mutations in Ppfia4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Ppfia4 APN 1 134328086 missense probably benign 0.00
IGL01935:Ppfia4 APN 1 134317936 missense probably benign 0.02
IGL02008:Ppfia4 APN 1 134332391 missense probably damaging 1.00
R0037:Ppfia4 UTSW 1 134324089 missense probably damaging 1.00
R0084:Ppfia4 UTSW 1 134299426 missense possibly damaging 0.84
R0108:Ppfia4 UTSW 1 134324217 splice site probably null
R0109:Ppfia4 UTSW 1 134324217 splice site probably null
R0238:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0238:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0239:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0239:Ppfia4 UTSW 1 134329189 missense possibly damaging 0.89
R0254:Ppfia4 UTSW 1 134324224 splice site probably benign
R0445:Ppfia4 UTSW 1 134327289 missense probably benign 0.31
R0504:Ppfia4 UTSW 1 134324113 missense probably damaging 1.00
R0617:Ppfia4 UTSW 1 134328780 missense probably damaging 1.00
R0839:Ppfia4 UTSW 1 134328807 missense probably null 1.00
R0849:Ppfia4 UTSW 1 134319372 missense probably benign 0.45
R0898:Ppfia4 UTSW 1 134321126 missense probably benign
R1173:Ppfia4 UTSW 1 134332283 splice site probably benign
R1728:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1729:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1730:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1762:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1783:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1784:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1785:Ppfia4 UTSW 1 134299321 missense probably benign 0.00
R1812:Ppfia4 UTSW 1 134324573 missense probably benign 0.04
R2148:Ppfia4 UTSW 1 134312634 missense probably benign 0.25
R2160:Ppfia4 UTSW 1 134313723 missense probably benign 0.40
R2308:Ppfia4 UTSW 1 134332397 missense possibly damaging 0.94
R2421:Ppfia4 UTSW 1 134327400 missense probably benign 0.00
R3694:Ppfia4 UTSW 1 134312567 missense probably damaging 1.00
R3707:Ppfia4 UTSW 1 134309660 missense probably damaging 0.99
R3708:Ppfia4 UTSW 1 134309660 missense probably damaging 0.99
R3725:Ppfia4 UTSW 1 134313711 missense probably benign 0.04
R3964:Ppfia4 UTSW 1 134323016 missense probably benign
R4889:Ppfia4 UTSW 1 134300514 missense probably damaging 1.00
R4909:Ppfia4 UTSW 1 134332501 missense probably damaging 0.97
R4939:Ppfia4 UTSW 1 134328079 missense possibly damaging 0.67
R5226:Ppfia4 UTSW 1 134304286 critical splice donor site probably null
R5433:Ppfia4 UTSW 1 134317894 missense probably damaging 1.00
R5576:Ppfia4 UTSW 1 134323050 missense possibly damaging 0.81
R5727:Ppfia4 UTSW 1 134324077 critical splice donor site probably null
R5793:Ppfia4 UTSW 1 134312106 missense probably damaging 1.00
R6193:Ppfia4 UTSW 1 134324161 missense probably benign 0.04
R6216:Ppfia4 UTSW 1 134329183 missense probably damaging 1.00
R6679:Ppfia4 UTSW 1 134309679 missense probably damaging 1.00
R6742:Ppfia4 UTSW 1 134329171 missense probably damaging 1.00
R7039:Ppfia4 UTSW 1 134312115 missense probably damaging 0.97
R7206:Ppfia4 UTSW 1 134327389 missense probably benign 0.00
R7259:Ppfia4 UTSW 1 134313100 missense probably damaging 1.00
R7454:Ppfia4 UTSW 1 134324135 missense possibly damaging 0.87
R8139:Ppfia4 UTSW 1 134300528 missense probably benign 0.01
Z1176:Ppfia4 UTSW 1 134327379 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGCTCAGGTGGCTTTACCAATATG -3'
(R):5'- AACAAAGATCTCCAAGGTGGCTGAC -3'

Sequencing Primer
(F):5'- AGTCCACTGGGCTCCAC -3'
(R):5'- GGCACCAGTTAGCCATCTTG -3'
Posted On2013-08-06